Coffee Science Alert n° 16
February 2008
AGRONOMY
Insecticidal activity of caffeine aqueous solutions and caffeine oleate emulsions against Drosophila melanogaster and Hypothenemus hampei
Araque, P.; Casanova, H.; Ortiz, C.; Henao, B.; Pelaez, C.
The bioactivity of caffeine aqueous solutions (0.20-2.00 wt %) and caffeine oleate emulsions (20 vol % oil, 2.00 wt % surfactant, 0.04 wt % caffeine, 0.05 wt % oleic acid) was assessed against two biological models: Drosophila melanogaster and Hypothenemus hampei. The caffeine aqueous solutions showed no insecticidal activity, whereas caffeine oleate emulsions had high bioactivity against both D. melanogaster and H. hampei. By preparing the caffeine oleate emulsions with anionic surfactants (i.e., sodium lauryl sulfate, sodium laureate, and sodium oleate), we obtained a lethal time 50 (LT50) of 23 min. In the case of caffeine oleate emulsions prepared with nonionic surfactants (i.e., Tween 20 and Tween 80), a LT50 of approximately 17 min was observed. The high bioactivity of the caffeine oleate emulsion against H. hampei opens the possibility of using this insecticide formulation as an effective way to control this pest that greatly affects coffee plantations around the world.
Source : J Agric Food Chem 2007 vol.55 (17), pp 6918 - 6922
Caveats to quantifying ecosystem services: fruit abortion blurs benefits from crop pollination
Bos, M. M.; Veddeler, D.; Bogdanski, A. K.; Klein, A. M.; Tscharntke, T.; Steffan-Dewenter, I.; Tylianakis, J. M.
The recent trend to place monetary values on ecosystem services has led to studies on the economic importance of pollinators for agricultural crops. Several recent studies indicate regional, long-term pollinator declines, and economic consequences have been derived from declining pollination efficiencies. However, use of pollinator services as economic incentives for conservation must consider environmental factors such as drought, pests, and diseases, which can also limit yields. Moreover, "flower excess" is a well-known reproductive strategy of plants as insurance against unpredictable, external factors that limit reproduction. With three case studies on the importance of pollination levels for amounts of harvested fruits of three tropical crops (passion fruit in Brazil, coffee in Ecuador, and cacao in Indonesia) we illustrate how reproductive strategies and environmental stress can obscure initial benefits from improved pollination. By interpreting these results with findings from evolutionary sciences, agronomy, and studies on wild-plant populations, we argue that studies on economic benefits from pollinators should include the total of ecosystem processes that (1) lead to successful pollination and (2) mobilize nutrients and improve plant quality to the extent that crop yields indeed benefit from enhanced pollinator services. Conservation incentives that use quantifications of nature's services to human welfare will benefit from approaches at the ecosystem level that take into account the broad spectrum of biological processes that limit or deliver the service.
Source : Ecol.Appl 2007 vol.17 (6), pp 1841 - 1849
Morphological and physiological responses of two coffee progenies to soil water availability
Dias, P. C.; Araujo, W. L.; Moraes, G. A.; Barros, R. S.; DaMatta, F. M.
Drought is a major environmental constraint affecting growth and production of coffee. The effects of water supply on growth, biomass allocation, water relations, and gas exchange in two coffee progenies representing drought-tolerant (Siriema) and drought-sensitive (Catucai) genotypes were compared. They were grown in 12-L pots until 4-months old, when they were submitted to two watering treatments for 60d: plants receiving either 100% transpired water (control plants) or a fraction (about 40%) of the amount of water transpired by control plants (drought-stressed plants). Under control conditions, Siriema grew faster than Catucai. Regardless of the watering regimes and progenies, relative growth rate (RGR) was positively correlated both with net assimilation rate (NAR) and long-term water-use efficiency (WUE), but not with differences in biomass allocation. Both progenies responded to drought stress through (i) similar decreases in both RGR and NAR with marginal, if any, changes in allocation; (ii) decreases in leaf water potential, which occurred to a greater extent in Catucai than in Siriema, even though they have showed similar abilities to adjust osmotically and elastically; (iii) similar reductions in net photosynthesis due mainly to nonstomatal factors; and (iv) decreases in transpiration rate coupled with increased long-term WUE. However, the lower transpiration rate and the higher long-term WUE as found in Siriema relative to Catucai under control conditions persisted under drought conditions. Overall, the major differences between these progenies were largely associated with differences in plant water use, which was likely related to the improved water status of Siriema. The possible implications of selecting coffee genotypes for high WUE are discussed.
Source : J Plant Physiol 2007 vol.164 (12), pp 1639 - 1647
The 15N isotope to evaluate fertilizer nitrogen absorption efficiency by the coffee plant
Fenilli, T. A.; Reichart, K.; Bacchi, O. O.; Trivelin, P. C.; Dourado-Neto, D.
The use of the 15N label for agronomic research involving nitrogen (N) cycling and the fate of fertilizer-N is well established, however, in the case of long term experimentation with perennial crops like citrus, coffee and rubber tree, there are still shortcomings mainly due to large plant size, sampling procedures, detection levels and interferences on the system. This report tries to contribute methodologically to the design and development of 15N labeled fertilizer experiments, using as an example a coffee crop fertilized with 15N labeled ammonium sulfate, which was followed for two years. The N of the plant derived from the fertilizer was studied in the different parts of the coffee plant in order to evaluate its distribution within the plant and the agronomic efficiency of the fertilizer application practice. An enrichment of the fertilizer-N of the order of 2% 15N abundance was sufficient to study N absorption rates and to establish fertilizer-N balances after one and two years of coffee cropping. The main source of errors in the estimated values lies in the inherent variability among field replicates and not in the measurements of N contents and 15N enrichments of plant material by mass-spectrometry.
Source : An Acad Bras Cienc 2007 vol.79 (4), pp 767 - 776
Comportamento de acasalamento do bicho-mineiro-do-cafeeiro, Leucoptera coffeella (Guerin-Meneville) (Lepidoptera: Lyonetiidae). [Mating behavior of the coffee leaf-miner Leucoptera coffeella (Guerin-Meneville) (Lepidoptera: Lyonetiidae)]
Michereff, M. F.; Michereff-Filho, M.; Vilela, E. F.
Despite the importance of Leucoptera coffeella (Guerin-Meneville) in coffee production worldwide, there is a lack of information on its reproductive biology. This knowledge will help in mass rearing, as well as support the development of behavioral control techniques for this insect. The purpose of the study was to determine the periodicity of mating and male capture and describe the mating behavior L. coffeella. In laboratory, we observed the periodicity of mating with virgin couples of different ages, zero to five days after emergence. Male activity was studied in a 0.7 ha coffee plantation, cv. Catuai, where Delta traps were installed at 0.5 m above ground, using either virgin females or rubber septa lured with the synthetic sex pheromone. The sequence of mating behavior was studied by making visual observations and recorded of pairs placed on individual plastic tubes. Mating occurred between 4h and 6h of photophase, when the highest frequencies involved pairs with ages of one and three days after emergence, with peak of mating occurring in 5th hour of photophase. The young or old pairs showed significantly copulation frequency and the peak of matings advance in 1h. The highest male capture occurred at 12p.m. and 13 p.m. by traps with virgin females or traps with synthetic sex pheromone lures, respectively. L. coffeella is one insect with diurnal mating and the mating behavior was not different from what is know for other Lepidoptera species.
Source : Neotrop Entomol 207 vol.36 (3), pp 376 - 382
Coffee leaf volatiles and egg laying by the coffee leaf miner Leucoptera coffeella
Magalhãesa T.S.V.; Guedesa, R.N.C.; Limaa E. R.; Demunerc A.J.
Recent reports of coffee genotypes resistant to one of its key pests in the Neotropical region, the leaf miner Leucoptera coffeella (Lepidoptera: Lyonetiidae), sparked studies trying to recognize the underlying causes of resistance. An association between increased egg laying by the leaf miner and increased caffeine levels in coffee leaves was recently recognized. However, since caffeine is not volatile, its effect on egg laying is likely aided by a volatile compound. This was the hypothesis tested here. Coffee leaf volatiles from 12 coffee genotypes were collected, analyzed (gas chromatograph coupled with a mass spectrometer (CG/MS)) and tested for electrophysiological activity (EAG). The active volatiles thus recognized were subjected to partial correlation against the density of eggs laid by the leaf miner in each coffee genotype. The volatile showing significant positive correlation, p-cymene, was subjected to an attraction test in a four-arm olfactometer confirming its biological activity and providing evidence of its role stimulating egg laying by the coffee leaf miner.
Source : Crop Protection 2008 vol.27 (6), pp 1038-1041
BIOCHEMISTRY / BIOTECHNOLOGY
Evaluation of DNA extraction methods from green and roasted coffee beans
Spaniolas, S.; Tsachaki, M.; Bennett, M. J.; Tucker, G. A.
This paper describes a generic approach to the evaluation of DNA extraction methodology using green and roasted coffee beans as a model commodity. The use of Design-Expert(R) software was used in the design of experimental work to compare and optimize yields using a variety of commercial DNA extraction kits. The quality of the extracted DNA in terms of PCR inhibitor content is assessed and a judgment made that GeneSpin represents perhaps the best methodology in this instance. Coffee is a major commercial crop and there is the potential for fraudulent adulteration of the more expensive Arabica with Robusta beans. It is demonstrated that the DNA extracted from both green and roasted beans could be used in a PCR-RFLP based analysis to differentiate between Arabica and Robusta types of coffee.
Source : Food Control 2008 vol.19 (3), pp 257 - 262
A novel caffeine dehydrogenase in Pseudomonas sp. strain CBB1 oxidizes caffeine to trimethyluric acid
Yu, C. L.; Kale, Y.; Gopishetty, S.; Louie, T. M.; Subramanian, M.
A unique heterotrimeric caffeine dehydrogenase was purified from Pseudomonas sp. strain CBB1. This enzyme oxidized caffeine to trimethyluric acid stoichiometrically and hydrolytically, without producing hydrogen peroxide. The enzyme was not NAD(P)(+) dependent; coenzyme Q(0) was the preferred electron acceptor. The enzyme was specific for caffeine and theobromine and showed no activity with xanthine.
Source : J Bacteriol 2008 vol.190 (2), pp 772 - 776
Effects of caffeine on stereoselectivities of high cell density biotransformations of cyclic beta-keto esters with Saccharomyces cerevisiae
Bohn, M.; Leppchen, K.; Katzberg, M.; Lang, A.; Steingroewer, J.; Weber, J.; Bley, T.; Bertau, M.
Caffeine affects the stereoselectivity of microbial high cell density reductions with commercial grade Saccharomyces cerevisiae (Baker's yeast). Cyclic beta-keto esters ethyl 2-oxocyclopentanoate (1) and ethyl 2-oxocyclohexanoate (3) were shown to be reduced with increased diastereoselectivity (1: 90.1 --> 92.1% de, 3: 75.0 --> 90.0% de) after addition of caffeine. Effects on enantioselectivity were less pronounced (1: 97.3 --> 98.5% ee, 3: 90.1 --> 92.1% ee). The observations are ascribed to the action of caffeine on cellular calcium homeostasis. These effects are accompanied by caffeine-induced cell-death, which preferably takes effect on pre-stressed cells which were found to decrease diastereoselectivity.
Source : Org Biomol Chem 2007 vol.5 (21), pp 3456 - 3463
Biosynthesis of chlorogenic acids in growing and ripening fruits of Coffea arabica and Coffea canephora plants
Koshiro, Y.; Jackson, M. C.; Katahira, R.; Wang, M. L.; Nagai, C.; Ashihara, H.
Chlorogenic acids are major secondary metabolites found in coffee seeds. The accumulation of chlorogenic acids and free quinic acids was studied in Coffea arabica cv. Tall Mokka and Coffea canephora seeds. Growth stages are specified from I to V, corresponding to rapid expansion and pericarp growth (I), endosperm formation (II), mature (green) (III), ripening (pink) (IV), and fully ripened (red) (V) stages. We detected monocaffeoylquinic acids (3CQA, 4CQA and 5CQA), dicaffeoylquinic acids (3,4diCQA, 3,5diCQA and 4,5diCQA) and a monoferuloylquinic acid (5FQA) in whole fruits (stage I), pericarps and seeds. The most abundant chlorogenic acid was 5CQA, which comprised 50-60% of the total of C. arabica and 45-50% of C. canephora seeds. The content of dicaffeoylquinic acid, mainly 3,5- diCQA, was high in C. canephora. A high content of 5FQA was found in seeds of stages III to V, especially in C. canephora. Total chlorogenic acids were accumulated up to 14 mg per fruit in C. Arabica and 17 mg in C. canephora, respectively. In contrast, free quinic acid varied from 0.4-2.0 mg (C. arabica) and 0.2-4.0 mg (C. canephora) per fruit during growth. High biosynthetic activity of 5CQA, which was estimated via the incorporation of [U-14C]phenylalanine into chlorogenic acids, was found in young fruits(perisperm and ericarp) in stage I, and in developing seeds (endosperm) in stages II and III. The biosynthetic activity of chlorogenic acids was clearly reduced in ripening and ripe seeds, especially in C canephora. Transcripts of PAL1, C3'H and CCoAMT, three genes related to the chlorogenic acid biosynthesis, were detected in every stage of growth, although the amounts were significantly less in stage V. Of these genes, CCoAMT, a gene for FQA biosynthesis, was expressed more weakly in stage I. The transcript level of CCoAMT was higher in seeds than in pericarp, but the reverse was found in PAL1. The pattern of expression of genes for the CQA and FQA synthesis is roughly related to the estimated biosynthetic activity, and to the accumulation pattern of chlorogenic acids.
Source : Z Naturforsch [C] 2007 vol.62 (9-10), pp 731 - 742
Towards a Phylogeny for Coffea (Rubiaceae): Identifying Well-supported Lineages Based on Nuclear and
Maurin, O.; Davis, A. P.; Chester, M.; Mvungi, E. F.; Jaufeerally-Fakim, Y.; Fay, M. F.
The phylogenetic relationships between species of Coffea and Psilanthus remain poorly understood, owing to low levels of sequence variation recovered in previous studies, coupled with relatively limited species sampling. In this study, the relationships between Coffea and Psilanthus species are assessed based on substantially increased molecular sequence data and greatly improved species sampling. Methods Phylogenetic relationships are assessed using parsimony, with sequence data from four plastid regions [trnL-F intron, trnL-F intergenic spacer (IGS), rpl16 intron and accD-psa1 IGS], and the internal transcribed spacer (ITS) region of nuclear rDNA (ITS 1/5.8S/ITS 2). Supported lineages in Coffea are discussed within the context of geographical correspondence, biogeography, morphology and systematics. Key Results Several major lineages with geographical coherence, as identified in previous studies based on smaller data sets, are supported. Other lineages with either geographical or ecological correspondence are recognized for the first time. Coffea subgenus Baracoffea is shown to be monophyletic, but Coffea subgenus Coffea is paraphyletic. Sequence data do not substantiate the monophyly of either Coffea or Psilanthus. Low levels of sequence divergence do not allow detailed resolution of relationships within Coffea, most notably for species of Coffea subgenus Coffea occurring in Madagascar. The origin of C. arabica by recent hybridization between C. canephora and C. eugenioides is supported. Phylogenetic separation resulting from the presence of the Dahomey Gap is inferred based on sequence data from Coffea.
Source : Ann Bot.(Lond) 2007 vol.100 (7), pp 1565 - 1583
Development of genomic microsatellite markers in Coffea canephora and their transferability to other coffee species
Poncet, V.; Dufour, M.; Hamon, P.; Hamon, S.; de Kochko, A.; Leroy, T.
Of the 103 accepted Coffea species, 70% are threatened with extinction but only a few of them have been studied. A set of 40 polymorphic microsatellite markers was developed using a GA/GT-enriched Coffea canephora genomic library. Amplification of these markers was tested in accessions of C. heterocalyx (a Critically Endangered species) and C. pseudozanguebariae (a Vulnerable species) belonging to different African geographical clades. All microsatellites were polymorphic in C. canephora, with a mean allele number per polymorphic locus of more than 3 (at least 9 genotypes were tested). Observed and expected heterozygosities calculated for C. canephora and C. pseudozanguebariae varied from 0.10 to 0.91 and from 0.20 to 0.77, respectively. In total, 38 primer pairs (95%) were amplified in C. heterocalyx and C. pseudozanguebariae, indicating their high level of transferability across the genus Coffea. This large marker set will be useful for more extensive genetic studies of threatened Coffea species.
Source : Genome 2007 vol.50 (12), pp 1156 - 1161
Characterization of Coffea chloroplast microsatellites and evidence for the recent divergence of C. Arabica and C. eugenioides chloroplast genomes
Tesfaye, K.; Borsch, T.; Govers, K.; Bekele, E.
Comparative sequencing of >7 kb of highly variable chloroplast genome regions (atpB-rbcL, trnS-trnG, rpl22-rps19, and rps19-rpl2 spacers; introns in atpF, trnG, trnK, and rpl16) with microsatellites known from other angiosperms was carried out in Coffea. Samples comprised 8 diploid species of Coffea, 5 individuals of tetraploid C. arabica representing geographically distant wild populations from Ethiopia, 2 commercial cultivars of C. arabica, and Psilanthus leroyi and Ixora coccinea as outgroups. Phylogeny reconstruction using maximum parsimony and Bayesian inference resulted in congruent topologies with high support for C. arabica and C. eugenioides being sisters. Partitioned analyses showed that all regions 68 except the atpB-rbcL spacer resolved this sister-group, although this was often unsupported. The large sequence data set further shows that chloroplast genomes of C. arabica and C. eugenioides each possess apomorphies, indicating that not C. eugenioides but an ancestor or close relative of C. eugenioides is the maternal parent of C. arabica. Seven variable chloroplast microsatellites were characterized in Coffea. Most microsatellites are poly(A/T) stretches, whereas one in the trnS-trnG spacer has an (AT)n motif. Most strikingly, all individuals of C. arabica possess identical sequences, suggesting a single chloroplast haplotype. This can be explained by a recent origin of C. arabica in a unique allopolyploidization event, or by severe bottleneck effects in the evolutionary history of the species. Reconstruction of the evolution of microstructural mutations shows much higher levels of homoplasy in microsatellite loci than in other parts of spacers and introns. Microsatellites are inferred to evolve by insertion and deletion of 1 to 3 motif copies in one step.
Source : Genome 2007 vol.50 (12), pp 1112 - 1129
MICROBIOLOGY
Water activity and temperature effects on growth of Aspergillus niger, A. awamori and A. carbonarius isolated from different substrates in Argentina
Astoreca, A.; Magnoli, C.; Ramirez, M. L.; Combina, M.; Dalcero, A.
The objectives of this study were to determine the effect of water activity, temperature, and their interactions on (a) mycelial growth rate and (b) the lag phase prior to grow of seven isolates of Aspergillus section Nigri isolated from peanuts, maize kernels, dried grapes and coffee cherries from Argentina. Three Aspergillus niger, three A. awamori and one A. carbonarius isolates examined showed optimum aW level for growth at 0.97 with optimal temperature of 30°C. for most of the isolates and 25°C for only one (A. awamori RCP176). Minimal aW for growth was 0.85 at the highest temperature tested. Overall growth was reduced up to 50% at 0.93 aW. Growth was also to a large extend inhibited at 0.85 aW for most isolates even after 21 days of incubation at temperatures lower than 30°C. The analysis of variance of the effect of single (isolate, aW and temperature), two- and three-way interaction showed that all factors alone and all interactions were statistically significant (P < 0.001) in relation to growth rates and lag phase for A. niger, A. awamori and A. carbonarius isolates. These data are relevant since these species are isolated in high frequency on numerous substrates for human and animal consumption inArgentina.
Source : Intern J Food Microbiol 2007 vol.119 (3), pp 314 - 318
Control of foodborne pathogens and spoilage microorganisms by naturally occurring antimicrobials
Beuchat, L. R.
The following topics are presented in this chapter: introduction; antimicrobials of plant origin, including Allium species, spices and herbs, plant pigments, other phenolic compounds, organic acids, coffee, tea, kola and cocoa, phytoalexins, and propolis; and antimicrobials of animal origin, including lytic enzymes, peroxidases and oxidases, and transferrins.
Leuconostoc holzapfelii sp. nov., isolated from Ethiopian coffee fermentation and assessment of sequence analysis of housekeeping genes for delineation of Leuconostoc species
De Bruyne, K.; Schillinger, U.; Caroline, L.; Boehringer, B.; Cleenwerck, I.; Vancanneyt, M.; De Vuyst, L.; Franz, C. M.; Vandamme, P.
A Gram-positive, ovoid lactic acid bacterium, strain LMG 23990(T), was isolated from Ethiopian coffee fermentation. 16S rRNA gene sequence analysis indicated that the novel strain belongs to the genus Leuconostoc, with Leuconostoc citreum and Leuconostoc lactis as the closest neighbours (99.6 and 99.0 % 16S rRNA gene sequence similarity, respectively). Genotypic fingerprinting by fluorescent amplified fragment length polymorphism, whole-cell protein electrophoresis, DNA-DNA hybridizations, comparative sequence analysis of pheS, rpoA, atpA, and physiological and biochemical tests allowed us to differentiate strain LMG 23990(T) from all established Leuconostoc species. Strain LMG 23990(T) (=CCUG 54536(T)) therefore represents a novel species, for which the name Leuconostoc holzapfelii sp. nov. is proposed.
Source : Int J Syst Evol Microbiol 2007 vol.57 (Pt 12), pp 2952 - 2959
Influence of dietary catechols on the growth of enteropathogenic bacteria
Freestone, P.-P. E.; Walton, N. J.; Haigh, R. D.; Lyte, M.
The dietary constituents that may act, in the broadest sense, as co-factors to enable bacterial enteropathogens to replicate in gastrointestinal environments are still largely unknown. Recent work has demonstrated that certain non-nutritional components of food, such as the catecholamines, can contribute to the ability of Gram-negative pathogens to replicate in iron-restrictive media that may be reflective of gastrointestinal environments. The present report examines whether other, non-catecholamine, dietary catechols, which occur widely in plant foods, can also influence enteropathogen growth in an iron restrictive environment such as might be found in the gastrointestinal tract. In the present study, we have examined the ability of a range of catechol-rich foodstuffs, ranging from beverages (tea and coffee) to fruit and vegetable extracts, as well as purified preparations of commonly consumed dietary catechols (catechins, chlorogenic acid, caffeic acid and tannic acid), to modulate the growth of the Gram-negative enteric pathogens Escherichia coli O157:H7 and Salmonella enterica SV Enteriditis. Time-dependent growth in response to dietary catechols (0.05-5.0% v/v of beverage or fruit/vegetable extracts; 10-200 muM of purified catechols) was examined in an iron-replete, rich medium as well as in an iron-limited, basal medium designed to reflect the iron-restricted environment that is more characteristic of human and animal tissues. Results obtained in iron-replete, rich medium demonstrated dose-dependent bacteriostatic effects for certain catechols, consistent with previous studies. However, in iron-restricted medium, all of the dietary catechols produced marked growth stimulation of up to 4 logs greater than non-supplemented controls. Mechanistic studies measuring the uptake of radiolabelled 55Fe from 55Fe-labelled lactoferrin and transferrin in bacteria grown in the presence or absence of dietary catechols demonstrated that the ability of catechols to stimulate bacterial growth was dependent on the provision of iron from iron sequestering glycoproteins. Urea gel analysis of transferrin incubated in the presence of the dietary catechols confirmed that these compounds were directly chelating and removing transferrin-complexed iron. Analysis using E. coli O157:H7 entA and tonB mutants further showed that a functional siderophore synthesis and uptake system was required for the growth-stimulatory response. In contrast to previous studies, which have reported the anti-microbial activity of dietary catechols, the present study demonstrates that these non-nutritional components of foods can, under iron-restrictive conditions, provide iron and enable the growth of enteric bacterial pathogens.
Source : Intern J Food Microbiol 2007 vol.119 (3), pp 159 - 169
Penicillium strains as dominant degraders in soil for coffee residue, a biological waste unsuitable for fertilization
Fujii, K.; Takeshi, K.
Coffee residue is an agricultural waste which inhibits the growth of several crops. Therefore coffee residue-degrading microbes in soil were screened, isolated and characterized. Methods and Results: Forty isolates were obtained after enrichment culture of soil samples. Seven strains (fast degraders) showed strong degrading activity, while 18 strains (slow degraders) showed weak degrading activity. DNA analysis suggested that the fast degraders are Penicillium, and the slow degraders are Penicillium, Trichoderma/Hypocrea, Fusarium/Gibberella, Phaeoacremonium/Togninia or Acidocella. The all fast degraders are cellulolytic, mannolytic and pectinolytic. Conclusions: Although it is generally thought that fungi such as Trichoderma contribute largely to aerobic degradation of cellulosic biomass, our data suggested that Penicillium overwhelms them in coffee residue degradation. It was implied that polysaccharides in coffee residue are not degraded independently by different microbes, but degraded simultaneously by strains with cellulolytic, mannolytic and pectinolytic activity. Since there is no report of an ascomycete possessing all the three enzyme activities, the fast degraders are ecologically important and have the potential to be used as producers of the costly enzymes from agricultural wastes. Significance and Impact of Study: The present results advance our understanding of microbial degradation of a phytotoxic agricultural waste, and offer a new tool for recycling it.
Source : J Appl Microbiol 2007 vol.103 (6), pp 2713 - 2720
Influence de l\'interaction de la temperature et de l\'activite de l\'eau sur la croissance et la production de l\'ochratoxine A par Aspergillus niger, Aspergillus carbonarius et Aspergillus ochraceus sur un milieu de base cafe. [Influence of the interaction of temperature and water activity on the production of ochratoxin A and the growth of Aspergillus niger, Aspergillus carbonarius and Aspergillus ochraceus on coffee-based culture medium.]
Kouadio, A. I.; Lebrihi, A.; Agbo, G. N.; Mathieu, F.; Pfohl-Leszkowiz, A.; Dosso, M. B.
In the present study, the effect of temperature and water activity on fungal growth and ochratoxin production on coffee-based medium was assessed. Optimal growth of three Aspergillus strains was observed in the same ecological conditions, namely 30 degrees C and 0.99 water activity. Maximal daily growth is 11.2, 6.92, and 7.22 mm/day for Aspergillus niger, Aspergillus carbonarius, and Aspergillus ochraceus, respectively. However, ecological conditions for optimal ochratoxin production vary according to the toxinogenic strain, with water activity as a limiting factor. Such an ochratoxin A production is inhibited at 42 degrees C and 0.75 water activity. Correspondence between laboratory tested water activity and that measured on a sun-dried ripe cherry batch shows that the first 5 days of drying are critical for fungal growth and ochratoxin A production. Accordingly, artificial drying of cherries at temperatures above 42 degrees C will impede not only fungal growth but also contamination with ochratoxin A.
Source : Can J Microbiol 2007 vol.53 (7), pp 852 - 859
Detection and quantification of Aspergillus westerdijkiae in coffee beans based on selective amplification of beta-tubulin gene by using real-time PCR
Morello, L. G.; Sartori, D.; Oliveira-Martinez, A.-L. de; Vieira, M.-L. C.; Taniwaki, M. H.; Fungaro, M.-H. P.
Aspergillus westerdijkiae is a new species of fungus that was recently dismembered from Aspergillus ochraceus taxon. Most isolates of A. westerdijkiae are able to produce large amounts of a mycotoxin called ochratoxin A (OA). OA has been found in food and beverages, such as coffee. A. westerdijkiae is very similar to A. ochraceus, and several isolates previously identified as A. ochraceus are now identified as A. westerdijkiae. By using sequences of the beta-tubulin gene, we analyzed several isolates from Brazilian coffee bean samples, previously identified as A. ochraceus, to compare with those of A. westerdijkiae. In fact, most (84%) were identified as A. westerdijkiae. Since this species consistently produces large amounts of OA, we developed a specific primer-pair for detecting and quantifying it in coffee beans by using real-time PCR. The primers Bt2Aw-F 5'TGATACCTTGGCGCTTGTGACG and Bt2Aw-R 5'CGGAAGCCTAAAAAATGAAGAG provided an amplicon of 347 bp in all A. westerdijkiae isolates, and no cross-reaction was observed using DNA from A. ochraceus. The sensitivity of real-time PCR was more than 100 times higher than the cfu technique.
Source : Intern J Food Microbiol 2007 vol.119 (3), pp 270 - 276
PROCESSING
COD and BOD reduction from coffee processing wastewater using Avacado peel carbon
Devi, R.; Singh, V.; Kumar, A.
The aim of this study was the assessment of reduction of chemical oxygen demand (COD) and biological oxygen demand (BOD) of wastewater from coffee processing plant using activated carbon made up of Avacado Peels. The complete study was done in batch mode to investigate the effect of operating parameters. The results of the COD and BOD concentration reduction with avocado peel carbon (APC) and commercial activated carbon (CAC) were compared and optimum operating conditions were determined for maximum reduction. Adsorption isotherm was also studied besides the calculation of optimum treatment parameters for maximum reduction of COD and BOD concentration from effluent of the coffee processing plant. The maximum percentage reduction of COD and BOD concentration under optimum operating conditions using APC was 98.20% and 99.18% respectively and with CAC this reduction was 99.02% and 99.35% respectively. As the adsorption capacity of APC is comparable with that of CAC for reduction of COD and BOD concentration, it could be a lucrative technique for treatment of domestic wastewater generated in decentralized sectors.
Source : Bioresour Technol 2008 vol.99 (6), pp 1853 - 1860
Modeling heat and mass transfer during drying of green coffee beans using prolate spheroidal geometry
Hernandez-Diaz, W. N.; Ruiz-Lopez, I. I.; Salgado-Cervantes, M. A.; Rodriguez-Jimenes, G. C.; Garcia-
Alvarado, M. A.
A heat and mass transfer model in prolate spheroidal coordinates system was proposed to describe the drying of green coffee beans. The model describes the 3D moisture and temperature profiles inside the bean. The results were integrated over volume in order to obtain a drying kinetic equation for prolate spheroidal geometry. The average effective diffusivity of water as function of temperature and moisture was estimated at 45 and 60°C by slope method from experimental drying kinetic of green coffee beans. The expression obtained applied to drying kinetic equation reproduced approximately the experimental behavior.
Source : J Food Eng 2008 vol.86(1), pp 1 - 9
Assessing caffeine as an emerging environmental concern using conventional approaches
Moore, M. T.; Greenway, S. L.; Farris, J. L.; Guerra, B.
Organic wastewater contaminants, including pharmaceuticals, caffeine, and nicotine, have received increased scrutiny because of their detection in water bodies receiving wastewater discharge. Despite recent measurement in United States streams, caffeine's effect on freshwater organisms is not well documented. The present study measured caffeine's lethal and sublethal effects on the freshwater species, Ceriodaphnia dubia, Pimephales promelas, and Chironomus dilutus. These organisms, which are used in standard testing or effluent monitoring, were exposed to aqueous caffeine solutions under static exposure for 48 hours and daily renewed static exposure for 7 days. Averaged responses of 48-hour acute end points indicated that C. dubia was more sensitive to caffeine exposures (LC(50) = 60mg/L) than either P. promelas (LC(50) = 100 mg/L) or C. dilutus (LC(50) = 1,230 mg/L). Exposure response slopes confirmed these findings (3% mortality/mg/L for C. dubia; 0.5% mortality/mg/L for P. promelas; and 0.07% mortality/mg/L for C. dilutus). Comparative 7-day responses between C. dubia and P. promelas (LC(50) = 46 and 55 mg/L, respectively) were more similar than the broad range of acute values. Sublethal effects measured for caffeine exposure included impaired C. dubia reproduction (IC(50) = 44 mg/L) and inhibited P. promelas growth (IC(50) = 71 mg/L). According to the results of this study, combined with earlier studies reporting environmental concentrations and product half-lives, caffeine should pose negligible risk for most aquatic vertebrate and invertebrate organisms.
Source : Arch Environ Contam Toxicol 2008 vol.54 (1), pp 31 - 35
Cashew gum microencapsulation protects the aroma of coffee extracts
Rodrigues, R. A.; Grosso, C. R.
Microencapsulation of materials rich in volatile compounds by spray drying presents the challenge of removing water by vapourization without loss of odour and/or flavour components. Cryoconcentrated coffee extracts rich in odour components were used as a substrate core to evaluate microencapsulation with cashew gum from Anacardium occidentale L. In Brazil, cashew gum is a low cost alternative to the traditional Arabic gum. A suspension containing coffee extract and the wall material was dissolved in water and then passed through a spray dryer. Core microcapsules were microwave-assisted extracted (MAE) and the aroma protection of the microcapsules produced was evaluated using gas chromatography and mass spectroscopy (GC/MS). The external morphology and size distribution of the microcapsules were obtained by scanning electron microscopy (SEM) and light scattering techniques, respectively. When comparing Arabic and cashew gum microencapsulation of coffee extracts both wall materials were observed to have similar aroma protection, external morphology and size distribution. Sensory analysis was employed to examine flavour protection and consumer preference with microencapsulation. These biochemical, sensory and structural data suggest that low cost cashew gum is a well suited alternative for odour microencapsulation to the more costly Arabic gum currently used in Brazil.
Source : J Microencapsul 2008 vol.25 (1), pp 13 - 20
The storage of green coffee (Coffea arabica): decrease of viability and changes of potential aroma precursors
Selmar, D.; Bytof, G.; Knopp, S. E.
When green coffee is stored for a prolonged time the coffee quality decreases distinctively. Apart from well-known 'off-notes' that arise from undesired oxidations of lipids, a typical 'flattening' of the cup quality is detectable. In order to elucidate the biological causes for this phenomenon, differentially processed coffees (wet, dry, semi-dry processing), were stored under standard conditions for 2 years and analysed comprehensively. METHODS: Wet-processed coffee was stored either as parchment coffee, where the endocarp remained around the beans or as hulled beans. Viability of coffee seeds was estimated using the tetrazolium-test of seed viability. Changes in concentration of free amino acids and soluble carbohydrates were analysed by HPLC. KEY RESULTS: Whereas all other coffees lost viability within the first 6 months of storage, coffee beans stored within the parchment remained viable for >1 year. Glucose and fructose decreased slightly in the course of storage and glutamine content declined significantly. However, the changes observed in sugar and amino acid content were not correlated with the viability of the coffee beans. Consequently, neither typical metabolic reactions occurring within living cells nor characteristic post-mortem reactions could be responsible for the observed changes. As a result of post-mortem reactions in re-imbibed seeds, a characteristic bluish-green colour developed, putatively due to the oxidation of chlorogenic acids and subsequent reactions with primary amino compounds. This coloration might be an appropriate marker to substantiate if coffee seeds had been stored for an expanded time and putative quality losses were not relevant so far.
CONCLUSIONS: It is suggested that loss of viability is relevant for the aroma flattening. As neither metabolic nor post-mortem reactions were responsible for the observed changes, it is concluded that Maillard reactions that occur during storage might be the cause of the decrease in potential aroma precursors.
Source : Ann Bot.(Lond) 2008 vol.101 (1), pp 31 - 38
Physical model of heat and mass transfer in a spouted bed coffee roaster
Heyd, B.; Broyart, B.; Hernandez, J. A.; Valdovinos-Tijerino, B.; Trystram, G.
A key step in coffee processing is roasting, where green coffee beans are heated at high temp. (>190°C), initiating a series of complex chemical reactions. This process can be divided into 2 phases (drying at <160°C and roasting at >160°C). Therefore, the quality of coffee is highly correlated with bean temp. during roasting. The aim of this study was to measure and model coffee bean temp. and moisture content during the roasting process, in order to determine on-line quality of the product and allow control of the process. A spouted bed roaster, using hot air flow as heating medium, was used. The surface and center bean temp., as well as input and output air temp., were measured on-line. At each minute interval of roasting, samples of coffee beans were taken to measure the moisture content. A dynamic model, which takes in account heat and mass transfer at the surface and inside of the beans, was developed. This model, where only the water diffusivity in the bean was adjusted, gave a good prediction of bean temp. (centre and surface), average moisture content and output air temp. for all the experiments. However, in the industry, only the output air temp. can be measured. Consequently, this model could assist in on-line determination of the bean temp. and hence constitutes the first stage in developing a smart sensor for on-line checking, including quality control.
Source : Drying Technol 2007 vol.25 (7-9), pp 1243 - 1248
Preparation of glyceryl monostearate-based particles by PGSS(R) - application to caffeine
Sampaio-de-Sousa, A. R.; Simplicio, A. L.; Sousa, H.-C. de; Duarte, C.-M. M.
This study investigated the use of solid lipid particles of glyceryl monostearate, generated using supercritical fluids, as a carrier for caffeine. The lipid matrix was analysed for CO2 solubility as a function of temp. and for melting point depression as a function of pressure. After processing using the PGSS(R) technique (particles from gas saturated solutions), particle size distribution was analysed by laser diffraction and morphology by SEM. After loading with caffeine, the particles were also analysed by HPLC.
Source : J Supercritic Fluids 2007 vol.43 (1), pp 120 - 125
Chemical oxygen demand reduction in coffee wastewater through chemical flocculation and advanced oxidation processes
Zayas-Perez, T.; Geissler, G.; Hernandez, F.
The removal of the natural organic matter present in coffee processing wastewater through chemical coagulation-flocculation and advanced oxidation processes (AOP) had been studied. The effectiveness of the removal of natural organic matter using commercial flocculants and UV/H2O2, UV/O3 and UV/H2O2/O3 processes was determined under acidic conditions. For each of these processes, different operational conditions were explored to optimize the treatment efficiency of the coffee wastewater. Coffee wastewater is characterized by a high chemical oxygen demand (COD) and low total suspended solids. The outcomes of coffee wastewater treatment using coagulation-flocculation and photodegradation processes were assessed in terms of reduction of COD, color, and turbidity. It was found that a reduction in COD of 67% could be realized when the coffee wastewater was treated by chemical coagulation flocculation with lime and coagulant T-1. When coffee wastewater was treated by coagulation-flocculation in combination with UV/H2O2, a COD reduction of 86% was achieved, although only after prolonged UV irradiation. Of the three advanced oxidation processes considered, UV/H2O2, UV/O3 and UV/H2O2/O3, we found that the treatment with UV/H2O2/O3 was the most effective, with an efficiency of color, turbidity and further COD removal of 87%, when applied to the flocculated coffee wastewater.
Source : J Environ Sci (China) 2007 vol.19 (3), pp 300 - 305
CHEMISTRY / SENSORICS
Studies on extraction and antioxidant potential of green coffee
Madhava-Naidu, M.; Sulochanamma, G.; Sampathu, S. R.; Srinivas, P.
Green coffee conserves were prepared from the species Coffea arabica and Coffea robusta by flaking, powdering and extraction with solvent mixtures of isopropanol and water in different ratios and their antioxidant properties were investigated. The yields of conserves were highest 27% for C. Arabica and 29% for C. robusta, when isopropanol and water in ratio of 60:40 was employed. The total polyphenol content was determined and found to be higher (31.7-32.2%) in these conserves. At a concentration of 200ppm, coffee conserves from Arabica and Robusta, exhibited 92% and 88% antioxidant activity respectively in comparison to 95% for BHA. The conserves were analyzed by HPLC and three phenolic compounds could be identified. The chlorogenic acid, the major compound in the purified extracts (56±10%), was isolated and characterized by 1H and 13C NMR spectral data. While the caffeic acid part of the molecule was confirmed from the signals for aromatic protons and olefenic protons, the quinic acid group was evident from the signals for methine protons alpha to hydroxyl groups as well as for the methylene protons of the cyclohexane moiety. Similarly, 13C spectra showed signals for two carbonyl carbons, apart from eight signals corresponding to six aromatic and two olefenic carbons and signals for the six carbons in the cycloalkane side chain.
Source : Food Chem 2008 vol.107(1), pp 377 - 384
Discrimination between defective and non-defective Brazilian coffee beans by their volatile profile
Mancha-Agresti, P. D. C.; Franca, A. S.; Oliveira, L. S.; Augusti, R.
Coffee roasted in Brazil is reported to be of low quality as a result of the presence of defective coffee beans. Coffee flavour is related to the volatile compounds produced during roasting, and this study examined the feasibility of discriminating defective from non-defective coffee beans by their volatile profiles after roasting, with the aim of finding possible chemical markers for the detection of defective coffee beans in roasted coffee. Solid-phase microextraction of the roasted coffee headspace was used for volatile extraction and concentration. Volatile profiles were analysed using GC-MS. Substances were identified as possible markers for differentiating black, sour and immature beans from healthy coffee beans. Results from hierarchical cluster analysis confirmed that black and sour beans could be associated with fermentation of immature and healthy beans, respectively.
Source : Food Chem 2008 106 (2), pp 787-796
Interfacial rheology study of espresso coffee foam structure and properties
Piazza, L.; Gigli, J.; Bulbarello, A.
The physicochemical properties that influence foam formation and its stability in espresso coffee brew have remained unidentified. owing to the difficulty of studying foams, which are transient. In this study, the role of surfactants and proteins in the formation of a two-dimensional viscoelastic gel in espresso coffee foams was determined using dynamic oscillatory interfacial rheological measurements. Results suggested that the interaction between lipids and protein-like macromolecules influences the relative strength of the air/water interface's two-dimensional physical network. Mathematical descriptions of surface viscoelasticity, which include surfactant biopolymer transport to the interface, and particles coagulation can be used in describing the foaming mechanisms in the espresso coffee beverage.
Source : J Food Eng 2008 vol.84 (3), pp 420-429
Evaluation of methods used to determine ochratoxin A in coffee beans
Ahmed, N. E.; Farag, M. M.; Soliman, K. M.; Abdel-Samed, A. K.; Naguib, KhM
A comparative study was conducted to evaluate four previously reported methods that proved to have a recovery greater than 80% for the determination of different levels of ochratoxin A (OTA) in green and roasted coffee beans and to select an accurate, sensitive, and less-expensive technique between the existing methods. The results indicated that the Association of Official Analytical Chemists (AOAC) official method for the extraction of OTA in green coffee and determination by high-performance liquid chromatography (HPLC) is recommended as an efficient method for the routine analyses of OTA in green and ground roasted coffee beans. This method proved to be an accurate, sensitive, and less-expensive method that employs routine materials and available equipment. Although the immunoaffinity column/HPLC procedure tested showed a significantly higher percentage than the AOAC recommended method, it is recommended for use in processed coffee beans where low concentrations of OTA may be expected to be detected.
Source : J Agric Food Chem 2007 vol.55 (23), pp 9576 - 9580
Analysis of the headspace volatiles of freshly brewed arabica coffee using solid-phase microextraction
Akiyama, M.; Murakami, K.; Ikeda, M.; Iwatsuki, K.; Wada, A.; Tokuno, K.; Onishi, M.; Iwabuchi, H.
Headspace volatiles of freshly brewed drip coffee were investigated by GC-MS and GC/olfactometry (GC/O, CharmAnalysisTM) analyses. For this purpose, a solid-phase microextraction (SPME) sampling method for the headspace volatiles of freshly brewed drip coffee was developed. SPME fibre coated with divinylbenzene (DVB)/carboxen/polydimethylsiloxane (PDMS) was selected from 6 types, and sampling time was determined at 2 min. The headspace coffee volatiles stayed constant in proportion for the first 2 min to keep the freshness of the brewed coffee aroma. Using this sampling method, the headspace volatiles of freshly brewed drip coffee (Ethiopian arabica coffee, roast degree: L value; 23) were examined by GC/MS and GC/O analyses. From the GC/O results, 1-(3,4-dihydro-2H-pyrrol-2-yl)-ethanone (nutty roast odour) and 4-(4'-hydroxyphenyl)-2-butanone (raspberry ketone, sweet-fruity odour) were newly detected as components in the aroma of coffee.
Source : J Food Sci 2007 vol.72 (7), pp C388 - C396
Caffeine deprivation state modulates expression of acquired liking for caffeine-paired flavours
Chambers, L.; Mobini, S.; Yeomans, M. R.
Previous studies found that caffeine consumers acquired a liking for the flavour of novel caffeinated drinks when these drinks were consumed repeatedly in a caffeine-deprived, but not nondeprived, state. Expression of this acquired liking appeared acutely sensitive to current caffeine deprivation state, but the use of between-subjects designs confounded interpretation of those studies. The present study evaluated these findings further using a within-subject design, with one flavour paired with caffeine (CS + ) and the second with the absence of caffeine (CS-). During four CS + and four CS- training days, 32 moderate caffeine consumers alternatively consumed a novel flavoured drink a CS + paired with caffeine and a CS flavour paired with placebo. Participants evaluated both drinks before and after training in two motivational states: caffeine deprived and nondeprived. As predicted, pleasantness ratings for the caffeine-paired flavour increased overall. However, this acquired liking was only significant when tested in a caffeine deprived state. These data are consistent with a conditioned-flavour preference model and imply that expression of acquired liking for a novel caffeinated flavour depends on the need for the effects of caffeine at the time when the drink is evaluated.
Source : Q.J Exp Psychol (Colchester.) 2007 vol.60 (10), pp 1356 - 1366
Caffeine content of prepackaged national-brand and private-label carbonated beverages
Chou, K. H.; Bell, L. N.
Caffeine is a well-known stimulant that is added as an ingredient to various carbonated soft drinks. Due to its stimulatory and other physiological effects, individuals desire to know the exact amount of caffeine consumed from these beverages. This study analyzed the caffeine contents of 56 national-brand and 75 private-label store-brand carbonated beverages using high-performance liquid chromatography. Caffeine contents ranged from 4.9 mg/12 oz (IGA Cola) to 74 mg/12 oz (Vault Zero). Some of the more common national-brand carbonated beverages analyzed in this study with their caffeine contents were Coca-Cola (33.9 mg/12 oz), Diet Coke (46.3 mg/12 oz), Pepsi (38.9 mg/12 oz), Diet Pepsi (36.7 mg/12 oz), Dr Pepper (42.6 mg/12 oz), Diet Dr Pepper (44.1 mg/12 oz), Mountain Dew (54.8 mg/12 oz), and Diet Mountain Dew (55.2 mg/12 oz). The Wal-Mart store-brand beverages with their caffeine contents were Sam's Cola (12.7 mg/12 oz), Sam's Diet Cola (13.3 mg/12 oz), Dr Thunder (30.6 mg/12 oz), Diet Dr Thunder (29.9 mg/12 oz), and Mountain Lightning (46.5 mg/12 oz). Beverages from 14 other stores were also analyzed. Most store-brand carbonated beverages were found to contain less caffeine than their national-brand counterparts. The wide range of caffeine contents in carbonated beverages indicates that consumers would benefit from the placement of caffeine values on food labels.
Source : J Food Sci 2007 vol.72 (6), pp C337 - C342
Factors affecting the analysis of furan in heated foods
Crews, C.; Hasnip, S.; Roberts, D. P.; Castle, L.
Various experimental factors, which could affect the measurement of furan by automated headspace gas chromatography/mass spectrometry, have been investigated. It was established that furan was not lost during sample heating through leakage or decomposition. Deuterium-labelled furan, used as an internal standard, was stable with respect to incubation in the presence of food and stable in model food systems at raised temperature. Saturation of the aqueous phase of the sample with ammonium sulphate improved the partitioning of furan from samples into the headspace. There was a very small decrease in the peak areas of both d0-furan and d4-furan when heated at acid pH. For food samples heated at normal headspace incubation temperature (50 degrees C), the level of furan was highest at the most acidic conditions used (pH 2.4) and did not differ significantly between pH 5 and 10. Under strong heating, production of furan decreased markedly at very high pH. Quantification based on standard additions or on external calibration gave comparable results for foods containing furan at relatively low, moderate and high levels.
Source : Food Addit Contam 2007 vol.24 Suppl 1, pp 108 - 113
Isolation, identification, and quantification of roasted coffee antibacterial compounds
Daglia, M.; Papetti, A.; Grisoli, P.; Aceti, C.; Spini, V.; Dacarro, C.; Gazzani, G.
Coffee brew is a widely consumed beverage with multiple biological activities due both to naturally occurring components and to the hundreds of chemicals that are formed during the roasting process. Roasted coffee extract possesses antibacterial activity against a wide range of microorganisms, including Staphylococcus aureus and Streptococcus mutans, whereas green coffee extract exhibits no such activity. the naturally occurring coffee compounds, such as chlorogenic acids and caffeine, cannot therefore be responsible for the significant antibacterial activity exerted by coffee beverages against both bacteria. The very low minimum inhibitory concentration (MIC) found for standard glyoxal, methylglyoxal, and diacetyl compounds formed during the roasting process points to these alpha-dicarbonyl compounds as the main agents responsible for the antibacterial activity of brewed coffee against Sa. aureus and St. mutans. However, their low concentrations determined in the beverage account for only 50% of its antibacterial activity. The addition of caffeine, which has weak intrinsic antibacterial activity, to a mixture of alpha-dicarbonyl compounds at the concentrations found in coffee demonstrated that caffeine synergistically enhances the antibacterial activity of alpha-dicarbonyl compounds and that glyoxal, methylglyoxal, and diacetyl in the presence of caffeine account for the whole antibacterial activity of roasted coffee.
Source : J Agric Food Chem 2007 vol.55 (25), pp 10208 - 10213
Isolation and determination of alpha-dicarbonyl compounds by RP-HPLC-DAD in green and roasted coffee
Daglia, M.; Papetti, A.; Aceti, C.; Sordelli, B.; Spini, V.; Gazzani, G.
Glyoxal, methylglyoxal and diacetyl, formed as Maillard reaction products in heat-treated food, were determined in coffee extracts (coffee brews) prepared from green coffee beans and coffee beans roasted to differing degrees. These compounds have been reported to be mutagenic in vitro and genotoxic in experimental animals. More recently, alpha-dicarbonyl compounds have been implicated in the glycation process. Data obtained showed that small amounts of glyoxal and methylglyoxal occur naturally in green coffee beans. Their concn. increased in the early stages of roasting and then declined. Conversely, diacetyl was not found in green beans and formed later in the roasting process. Therefore, light and medium roasted coffee samples had the highest glyoxal and methylglyoxal contents, whereas dark roasted coffee contained smaller amounts of glyoxal, methylglyoxal and diacetyl. For determination of alpha-dicarbonyl compounds in coffee, a RP-HPLC with diode array detection method was devised that involves elimination of interfering compounds, such as chlorogenic acids, by solid phase extraction (SPE) and their derivatization with 1,2-diaminobenzene to give quinoxaline derivatives. Checks of SPE and derivatization conditions to verify recovery and yield, respectively, resulted in recovery rates of 100%. The results of the validation suggest that the proposed method is selective, precise, accurate and sensitive.
Source : J Agric Food Chem 2007 vol.55 (22):, pp 8877 - 8882
Coffee dietary fiber contents and structural characteristics as influenced by coffee type and technological and brewing procedures
Gniechwitz, D.; Brueckel, B.; Reichardt, N.; Blaut, M.; Steinhart, H.; Bunzel, M.
Coffee brews contain considerable amounts of soluble dietary fiber, mainly low substituted galactomannans and type II arabinogalactans. Factors possibly influencing the content and structures of dietary fiber in coffee brews, such as type of coffee, roasting and grinding degree, and brewing procedure, were studied. In addition, several commercial samples such as instant espresso, instant coffee, instant cappuccino, decaffeinated coffees, and coffee pads were analyzed. The dietary fiber contents of the coffee brews ranged from 0.14 to 0.65 g/100 mL (enzymatic-gravimetric methodology), proving an influence of the factors investigated. For example, the drip brew of an arabica coffee contained significantly more soluble dietary fiber than the drip brew of a comparable robusta coffee, and depending on the brewing procedure, the soluble dietary fiber content of beverages obtained from the same coffee sample ranged from 0.26 to 0.38 g/100 mL. Dietary fiber contents of coffee brews were enhanced only up to a certain degree of roast. Drip brews of decaffeinated arabica coffees (commercial samples) contained significantly less dietary fiber than any non-decaffeinated drip brew investigated in this study. The observed differences in the dietary fiber contents were accompanied by changes in the structural characteristics of fiber polysaccharides, such as galactomannan/arabinogalactan ratio, galactose substitution degree of mannans, or galactose/arabinose ratio of arabinogalactans as analyzed by methylation analysis.
Source : J Agric Food Chem 2007 vol.55 (26), pp 11027 - 11034
In vitro antioxidant activity of coffee compounds and their metabolites
Gomez-Ruiz, J. A.; Leake, D. S.; Ames, J. M.
In this paper we report the antioxidant activity of different compounds which are present in coffee or are produced as a result of the metabolism of this beverage. In vitro methods such as the ABTS*+ [ABTS =2,2'-azinobis(3-ethylbenzothiazoline-6-sulfonic acid)] decolorization assay and the oxygen radical absorbance capacity assay (ORAC) were used to assess the capacity of coffee compounds to scavenge free radicals. The importance of caffeine metabolites and colonic metabolites in the overall antioxidant activity associated with coffee consumption is shown. Colonic metabolites such as m-coumaric acid and dihydroferulic acid showed high antioxidant activity. The ability of these compounds to protect human low density lipoprotein (LDL) oxidation by copper and 2,2'-azobis(2-amidinopropane) dihydrochloride was also explored. 1-Methyluric acid was particularly effective at inhibiting LDL oxidative modification. Different experiments showed that this caffeine metabolite is not incorporated into LDL particles. However, at physiologically relevant concentrations, it was able to delay for more than 13 h LDL oxidation by copper.
Source : J Agric Food Chem 2007 vol.55 (17), pp 6962 - 6969
Quantification of 3-aminopropionamide in cocoa, coffee and cereal products
Granvogl, M.; Schieberle, P.
Based on recent results confirming 3-aminopropionamide (3-APA) as a precursor of acrylamide in the absence of other 'catalysts', this compound was quantified in cocoa masses, cocoa beans, coffee and cereal products by LC-MS-MS after derivatization with dansyl chloride. Cocoa masses contained >3000 mug/kg of 3-APA, but significant variations in 3-APA concn. were observed. For the quantification of acrylamide in cocoa and coffee, an improved isolation procedure using charcoal was developed. In various samples of unroasted and roasted cocoa beans, concn. of acrylamide were lower by a factor of >5 than those of 3-APA, but concn. of 3-APA and AA were more closely correlated than were concn. Of acrylamide and asparagine. Experiments on authentic cocoa beans from Ghana and Sulawesi indicated that the thermal generation of 3-APA during roasting was much more pronounced than its biochemical formation. By administering fermented cocoa beans with [13C4 15N2]-asparagine before roasting, 3-APA was confirmed as a transient intermediate in acrylamide formation during cocoa roasting. Among the cereal products analysed, popcorn contained particularly high amounts of 3-APA, which were also well correlated with acrylamide concn. However, in coffee products, 3-APA concn. was always lower than that of acrylamide.
Source : Eur Food Res Technol 2007 vol.225 (5-6), pp 857 - 863
Effect of roasting conditions on the polycyclic aromatic hydrocarbon content in ground Arabica coffee and coffee brew
Houessou, J. K.; Maloug, S.; Leveque, A. S.; Delteil, C.; Heyd, B.; Camel, V.
Roasting is a critical process in coffee production as it enables the development of flavor and aroma. At the same time, roasting may lead to the formation of nondesirable compounds, such as polycyclic aromatic hydrocarbons (PAHs). In this study, Arabica green coffee beans from Cuba were roasted under controlled conditions to monitor PAH formation during the roasting process. Roasting was performed in a pilot spouted bed roaster, with the inlet air temperature varying from 180 to 260 degrees C, using both dark (20 min) and light (5 min) roasting conditions. Several PAHs were determined in both roasted coffee samples and green coffee samples. Also, coffee brews, obtained using an electric coffee maker, were analyzed for final estimation of PAH transfer coefficients to the infusion. Formation of phenanthrene, anthracene, and benzo[a]anthracene in coffee beans was observed at temperatures above 220 degrees C, whereas formation of pyrene and chrysene required 260 degrees C. Low levels of benzo[g,h,i]perylene were also noted for dark roasting under 260 degrees C, with simultaneous partial degradation of three cycle PAHs, suggesting that transformation of low molecular PAHs to high molecular PAHs occurs as the roasting degree is increased. The PAH transfer to the infusion was quite moderate (<35%), with a slightly lower extractability for dark-roasted coffee as compared to light-roasted coffee.
Source : J Agric Food Chem 2007 vol.55 (23), pp 9719 - 9726
Release Kinetics of Volatile Organic Compounds from Roasted and Ground Coffee: Online Measurements by PTR-MS and Mathematical Modeling
Mateus, M. L.; Lindinger, C.; Gumy, J. C.; Liardon, R.
The present work shows the possibilities and limitations in modeling release kinetics of volatile organic compounds (VOCs) from roasted and ground coffee by applying physical and empirical models such as the diffusion and Weibull models. The release kinetics of VOCs were measured online by proton transfer reaction-mass spectrometry (PTR-MS). Compounds were identified by GC-MS, and the contribution of the individual compounds to different mass fragments was elucidated by GC/PTR-MS. Coffee samples roasted to different roasting degrees and ground to different particle sizes were studied under dry and wet stripping conditions. To investigate the accuracy of modeling the VOC release kinetics recorded using PTR-MS, online kinetics were compared with kinetics reconstituted from purge and trap samplings. Results showed that uncertainties in ion intensities due to the presence of isobaric species may prevent the development of a robust mathematical model. Of the 20 identified compounds, 5 were affected to a lower extent as their contribution to specific m/ z intensity varied by <15% over the stripping time. The kinetics of these compounds were fitted using physical and statistical models, respectively, the diffusion and Weibull models, which helped to identify the underlying release mechanisms. For dry stripping, the diffusion model allowed a good representation of the release kinetics, whereas for wet stripping conditions, release patterns were very complex and almost specific for each compound analyzed. In the case of prewetted coffee, varying particle size ( approximately 400-1200 microm) had no significant effect on the VOC release rate, whereas for dry coffee, the release was faster for smaller particles. The absence of particle size effect in wet coffee was attributed to the increase of opened porosity and compound diffusivity by solubilization and matrix relaxation. To conclude, the accurate modeling of VOC release kinetics from coffee allowed small variations in compound release to be discriminated. Furthermore, it evidenced the different aroma compositions that may be obtained depending on the time when VOCs are recovered.
Source : J Agric Food Chem 2007 vol.55 (25), pp 10117 - 10128
An improved application for the enzyme multipled immunoassay technique for caffeine, amikacin, and methotrexate assays on the Dade-Behring Dimension RxL Max clinical chemistry system
Mendu, D. R.; Chou, P. P.; Soldin, S. J.
Caffeine is widely used in children's hospitals to treat neonatal apnea. Amikacin is used for treating hospital-acquired infections caused by Gram-negative bacteria resistant to other aminoglycosides. The blood levels, however, have to be monitored carefully because of its ototoxicity and nephrotoxicity. Methotrexate (MTX) is used as a chemotherapeutic agent in the treatment of leukemia and lymphoma as well as of certain solid tumors. Current enzyme multiplied immunoassay technique (EMIT) assays for caffeine, amikacin, and MTX lack low-end precision. In addition, the EMIT assays for MTX lack the sensitivity of reliable quantification to 0.05 micromol/L needed because of today's more rigorous requirements. The goal of the present study was to optimize the EMIT method parameters on the Dimension RxL Max, thereby providing applications with improved precision for all the three analytes and enhancing the sensitivity of the EMIT methotrexate assay. Serum samples were measured for caffeine, amikacin, and MTX by EMIT on the Dimension RxL Max and by EMIT (on the Olympus AU 600 for caffeine) and fluorescence polarization immunoassay [for MTX and amikacin (FPIA; TDx FLx)] at Quest Diagnostics. The new instrument method parameters that use larger sample volumes and longer observation of optical density changes (caffeine, MTX) provide improved sensitivity for MTX permitting reliable measurement at 0.05 micromol/L and improved precision for all three analytes. Within- and between-day imprecision were less than 6% for low to high concentrations of caffeine and amikacin controls and are less than 7.5% for MTX concentrations greater than 0.3 micromol/L and 12.3% at 0.06 micromol/L. The correlation coefficients for caffeine, amikacin, and MTX plotted for the Dimension RxL Max versus the methods used at Quest Diagnostics were 0.973, 0.986, and 0.992, respectively. These EMIT method applications now compare well with other established assays. The new Dimension RxL Max method parameters provide greatly improved precision and also meet today's clinical sensitivity guidelines (0.05 micromol/L) for MTX.
Source : Ther Drug Monit 2007 vol.29 I(5), pp 632 - 637
Effect of operating conditions on ochratoxin A extraction from roasted coffee
Mounjouenpou, P.; Durand, N.; Guyot, B.; Guiraud, J. P.
Operating conditions affect ochratoxin A (OTA) extraction from roasted coffee. The OTA content found in the beverage can thus be greater than that found in the roasted coffee used to prepare it. Three extraction parameters were studied for roasted coffee: type of extraction solvent (alkaline, neutral, acid), temperature (ambient temperature/23 degrees C, 60 degrees C and 85 degrees C), and extraction time (5, 20, 30, 40, 50, 60 and 80 min). The alkaline solvent used in the method recommended by the European Union extracted OTA better, but a maximum content was obtained at 60 degrees C after 50 min. At least a 100% improvement in extraction was obtained when compared with the European Union usual quantification method that is carried out at ambient temperature. It turned out that the OTA extraction parameters for roasted coffee, as defined by that method, were not optimum and needed to be modified. These results were verified in double-extraction experiments showing that OTA is not completely extracted by this method. Confirmation was obtained by comparison of extraction methods on several commercial samples of roasted coffee.
Source : Food Addit Contam 2007 vol.24 (7), pp 730 - 734
Natural occurrence of ochratoxin a and antioxidant activities of green and roasted coffees and corresponding byproducts
Napolitano, A.; Fogliano, V.; Tafuri, A.; Ritieni, A.
Ochratoxin A is an important mycotoxin that can enter the human food chain in cereals, wine, coffee, spices, beer, cocoa, dried fruits, and pork meats. Coffee is one of the most common beverages and, consequently, it has a potential risk factor for human health related to ochratoxin A exposure. In this study, coffee and corresponding byproducts from seven different geographic regions were investigated for ochratoxin A natural occurrence by HPLC-FLD, nutritional characterization, and antioxidant activities by spectrophotometric assay. The research focused on composition changes in coffee during the processing step "from field to cup". Costa Rica and Indian green coffees were the most contaminated samples, with 13 and 11 microg/kg, respectively, while the Ethiopian coffee was the least contaminated, with 3.8 microg/kg of ochratoxin A. The reduction of ochratoxin A contamination during the roasting step was comparable for any samples that were considered under the recommended level of 4 microg/kg. Total dietary fibers ranged from 58.7% for Vietnam and 48.6% for Ivory Coast in green coffees and ranged from 58.6% for Costa Rica to 61.2% for India in roasted coffee. Coffee silverskin byproduct obtained from Ivory Coast was the highest, with 69.2 and 64.2% of insoluble dietary fibers, respectively.
Source : J Agric Food Chem 2007 vol.55 (25), pp 10499 - 10504
Determination of acrylamide in coffee and chocolate by pressurised fluid extraction and liquid chromatography-tandem mass spectrometry
Pardo, O.; Yusa, V.; Coscolla, C.; Leon, N.; Pastor, A.
A selective and sensitive procedure has been developed and validated for the determination of acrylamide in difficult matrices, such as coffee and chocolate. The proposed method includes pressurised fluid extraction (PFE) with acetonitrile, florisil clean-up purification inside the PFE extraction cell and detection by liquid chromatography (LC) coupled to atmospheric pressure ionisation in positive mode tandem mass spectrometry (APCI-MS-MS). Comparison of ionisation sources (atmospheric pressure chemical ionisation (APCI), atmospheric pressure photoionization (APPI) and the combined APCI/APPI) and clean-up procedures were carried out to improve the analytical signal. The main parameters affecting the performance of the different ionisation sources were previously optimised using statistical design of experiments (DOE). PFE parameters were also optimised by DOE. For quantitation, an isotope dilution approach was used. The limit of quantification (LOQ) of the method was 1 microg kg(-1) for coffee and 0.6 microg kg(-1) for chocolate. Recoveries ranged between 81-105% in coffee and 87-102% in chocolate. The accuracy was evaluated using a coffee reference test material FAPAS T3008. Using the optimised method, 20 coffee and 15 chocolate samples collected from Valencian (Spain) supermarkets, were investigated for acrylamide, yielding median levels of 146 microg kg(-1) in coffee and 102 microg kg(-1) in chocolate.
Source : Food Addit Contam 2007 vol.24 (7), pp 663 - 672
Lipoxygenase distribution in coffee (Coffea arabica L.) berries
Patui, S.; Peresson, C.; Braidot, E.; Tubaro, F.; Colussi, A.; Bonnlaender, B.; Macri, F.; Vianello, A.
In this paper lipoxygenase (LOX) presence was investigated in coffee berries to determine its involvement in lipid degradative metabolism of plants grown in organic and conventional cultivations. Immunochemical analysis detected a protein with a mol. wt. 80 kDa, which cross-reacted with an anti-LOX antibody, in the pulp fraction of berries obtained from plants in both cultivations. LOX activity in this fraction could be monitored either as conjugated diene formation or reaction products (determined by HPLC) and was mainly associated with a heavy membrane fraction (HMF, enriched in tonoplast, endoplasmic reticulum, plasma membrane and mitochondria) and a light membrane fraction (LMF, enriched in plasma membrane and endoplasmic reticulum, with low levels of tonoplast and mitochondria). Optimum LOX activity of LMF from berries of both cultivations was at pH 8.0. The HMF exhibited a different activity peak in samples from conventional (pH 8.0) and organic (pH 5.5) cultures, suggesting the presence of different isoenzymes. These findings were also confirmed by variation of the ratio of 9- and 13-hydroperoxides in organic (1:1) and conventional cultivations (1:10), indicating that the organic cultivation was subjected to oxidative stress in the coffee pulp fraction leading to the expression of an acidic LOX. It is concluded that such de novo synthesized LOX activity may be responsible for the production of secondary metabolites, which may interfere with the sensory properties of coffee.
Source : J Agric Food Chem 2007 vol.55 (20), pp 8223 - 8230
Fighting food fraud with science
Perks, B.
Techniques used to detect adulterants in foods are discussed, in relation to: use of NMR to detect adulteration of ingredients containing aloe vera; use of PCR to detect cows' milk as an adulterant of mozzarella cheese; DNA markers for olive oil authentication; methods to discriminate between Arabica and Robusta coffees; attempts to develop generic procedures for detection of adulteration; and identification of corn fed chicken.
Source : Chemistry World 2007 vol.4 (9), pp 48 - 52
Use of near-infrared spectroscopy and feature selection techniques for predicting the caffeine content and roasting color in roasted coffees
Pizarro, C.; Esteban-Diez, I.; Gonzalez-Saiz, J. M.; Forina, M.
NIR spectroscopy combined with diverse feature selection techniques and multivariate calibration methods was used to develop robust and reliable reduced-spectrum regression models based on a few NIR filter sensors for determining roasting colour and caffeine content, key parameters for the characterization and quality assurance of roasted coffees. Application of stepwise orthogonalization of predictors (SELECT) provided notably improved regression models for the 2 response variables modelled, with root mean square errors of the residuals in external prediction equal to 3.68 and 1.46% for roasting colour and caffeine content of roasted coffee samples, respectively. The improvement achieved using the SELECT-OLS method was particularly remarkable when the very low complexities associated with the final models obtained for predicting both roasting colour (9 selected wavelengths) and caffeine content (17 significant wavelengths) were taken into account. The simple and reliable calibration models proposed encourage the possibility of implementing them in online and routine applications to predict quality parameters of unknown coffee samples via their NIR spectra.
Source : J Agric Food Chem 2007 vol.55 (18), pp 7477 - 7488
Physicochemical characteristics of green coffee: comparison of graded and defective beans
Ramalakshmi, K.; Kubra, I. R.; Rao, L. J.
Defective (triage) coffee beans are beans rejected after separating the graded ones according to the size and color. These coffee beans represent about 15% to 20% of coffee production in India but are not utilized for beverages since these affect the quality of coffee brew. In the present study, physical characteristics such as bean density, brightness, titratable acidity, pH, moisture, and total soluble solids and also chemical composition, namely, caffeine, chlorogenic acids, lipids, sucrose, total polyphenols, and proteins, were evaluated in defective as well as in graded green coffee beans. The physical parameters such as weight, density, and brightness of defective coffee beans were low compared to the graded beans, which is due to the presence of immature, broken, bleached, and black beans. Caffeine content was low in triage beans compared to graded beans. Chlorogenic acids, one of the composition in coffee responsible for antioxidant activity, was found to be intact (marginally high in some cases) in defective coffee beans. Hence, triage coffee beans can be evaluated as a source of antioxidant or radical scavenging conserve for food systems.
Source : J Food Sci 2007 vol.72 (5), pp S333 - S337
Effect of in vitro enzymatic digestion on antioxidant activity of coffee melanoidins and fractions
Rufian-Henares, J. A.; Morales, F. J.
Traditionally antioxidant activity of melanoidins has only been evaluated in food for implication in shelf life but gastrointestinal digestion is necessary to study their potential bioactivity. In addition, the biological fate of melanoidins has been stressed during the past decade since they did not behave as inert substances. In the present paper a soluble coffee melanoidin isolated from brewed coffee after ultrafiltration with a 10 kDa cutoff membrane was treated ionically and enzymatically collecting the respective high and low molecular weight fractions. Antioxidant activity of these fractions was evaluated with five well-described assays (DPPH, ABTS, ORAC, HOSC, and FRAP) that were previously setup in a plate reader based automatized analysis. Low molecular weight compounds released from melanoidin after gastrointestinal digestion exerted the highest antioxidant activity, even higher than compounds bound ionically to melanoidins. Gastrointestinal digestion is able to modify coffee melanoidins to some extent, as hypothesized from their absolute antioxidant activities. Two options are plausible: by modifying/releasing the ionically bound compounds and/or by genesis of new more active structures from the melanoidin skeleton after enzymatic treatment.
Source : J Agric Food Chem 2007 vol.55 (24), pp 10016 - 10021
Shrivas, K.; Hui, Fen Wu
Optimization of a drop-to-drop solvent microextraction (DDSME) technique for use in GC-MS determination of caffeine in 1 drop of beverages or foods is described. Optimized DDSME is based on chloroform extraction with an extraction time of 5 min, 0.5 mul exposure vol. of extraction phase and no salt addition at room temp. The method showed good linearity (0.05-5.0 mug/l) and a limit of detection of 4.0 ng/ml; relative recoveries of caffeine from food and beverage samples ranged from 96.6 to 101%. It is concluded that the DDSME/GC-MS technique can be used as a simple rapid means of caffeine determination in food and other samples, with DDSME providing added advantages, such as rapidity and low solvent and sample consumption compared with standard caffeine extraction techniques.
Source : J Chromat A 2007 vol.1170 (1-2), pp 9 - 14
Influence of coffee on reflectance and chemistry of resin composite protected by surface sealant
Soares, L. E.; Cesar, I. C.; Santos, C. G.; De Cardoso, A. L.; Liporoni, P. C.; Munin, E.; Martin, A. A.
PURPOSE: To assess the influence of the light-curing unit type and whether or not it was worth using surface sealant protection on resin composite restorative materials stained by coffee. Another objective was to propose the monitoring of coffee staining by FT-Raman spectroscopy using carbon-hydrogen (CH) bonds as reference to the composite matrix degradation. METHODS: Sixty cylindrical specimens of resin composite were prepared and divided into six groups: HC (control)--cured with a halogen light; LC (control) cured with a LED; HF--cured with a halogen light + Fortify Plus; LF--cured with a LED + Fortify Plus; HP--cured with a halogen light + PermaSeal; LP--cured with a LED + PermaSeal. After storage for 24 hours at 37% and 100% of relative humidity, the top surface was protected, and the other surfaces isolated. Polishing with paper discs was performed after 24 hours of curing and prior to FT-Raman spectroscopy and reflectance measurements. All specimens were submitted to coffee staining for 14 days and evaluated by both systems. Results were statistically analyzed by ANOVA and Tukey tests. RESULTS: FT-Raman spectrum only showed significant changes in groups LC and LP (P< 0.05). Reflectance demonstrated that staining was present in all specimens protected by sealants. Sealant staining was larger in the HF (P < 0.001) group.
Source : Am J Dent 2007 vol.20 (5), pp 299 - 304
Determination of caffeine and caffeine-related metabolites in ephedra-containing Standard Reference Materials using liquid chromatography with absorbance detection and tandem mass spectrometry
Thomas, J. B.; Sharpless, K. E.; Mitvalsky, S.; Roman, M.; Yen, J.; Satterfield, M. B.
Concn. of caffeine and caffeine-related compounds in 2 ephedra-containing reference materials have been determined by 3 independent methods with measurements performed by the National Institute of Standards and Technology (NIST) and a collaborating laboratory. Results from the 3 methods were used for value assignment of caffeine, theobromine and theophylline in these Standard Reference Materials (SRM). The methods used at NIST to determine the concn. levels of caffeine, theobromine and theophylline in SRM 3243 Ephedra-Containing Solid Oral Dosage Form and SRM 3244 Ephedra-Containing Protein Powder used reversed-phase LC with absorbance detection and tandem MS. These reference materials are part of the first suite in a series of NIST SRM that provide concn. values for multiple components in food supplements. These SRM are primarily intended for method validation and for use as control materials to support the analysis of food supplements and similar materials.
Source : J AOAC Intern 2007 vol.90 (4), pp 934 - 940
In-house validation of a simple headspace gas chromatography-mass spectrometry method for determination of furan levels in food
Vranova, J.; Bednarikova, A.; Ciesarova, Z.
Furan and its derivatives are associated with the flavour of foods, and are formed during Maillard reactions. Furan has been classed as possibly carcinogenic to humans, and methods are required for its detection. In this study, a method for the determination of furan using a headspace GC-MS technique was validated for routine application in food control. Uncertainty statements for tomato ketchup confirmed that the method was suitable for the determination of furan in this product. The method was also used to determine furan in baby food, canned meat and vegetables, liquid seasoning, sauces and coffee.
Source : J Food Nutr Res 2007 vol.46 (3), pp 123-127
Enzyme-linked immunosorbent assay and colloidal gold immunoassay for ochratoxin A: investigation of analytical conditions and sample matrix on assay performance
Xiang, Hong Wang; Tao, Liu; Na, Xu; Yan, Zhang; Shuo, Wang
A polyclonal antibody against ochratoxin A (OTA) was produced from rabbits immunized with the OTA-BSA conjugate. A competitive direct ELISA (cdELISA) and a membrane-base colloidal gold immunoassay in flow-through format were developed for rapid detection of OTA in various food matrices. In the cdELISA, the concn. causing 50% inhibition was 0.07 ng/ml, and the effects of ionic strength, pH value and organic solvent were studied. The sensitivity of the assay was higher than that previously reported. A simple, rapid and efficient extraction method was developed and 74-110% recoveries of spiked samples were obtained. 50% methanol extracts of the 6 foods analysed, namely barley, wheat, oat, corn, rice and raisins, could be analysed directly by immunoassay after dilution in PBS, and grape juice and beer samples could also be analysed directly after dilution with PBS; however, for coffee samples, a more complex method was used to remove the matrix effect effectively. Membrane-based colloidal gold immunoassays had a visual detection limit of 1.0 ng/ml for OTA with a detection time of <10 min. For validation of the cdELISA and membrane-based colloidal gold immunoassay, samples were analysed by HPLC. The correlation between data obtained using the microwell assay and HPLC was good (R2 = 0.984). The developed immunoassays were found to be suitable for rapid detection or determination of OTA in food samples.
Source : Anal Bioanal Chem 2007 vol.389 (3), pp 903 - 911
Sex differences in preferences for coffee sweetness among Japanese students
Yamazawa, K.; Hirokawa, K.; Shimizu, H.
The purpose of the present study was to examine sex differences in preferences for coffee sweetness. The participants were 59 Japanese undergraduate students. Men preferred sweeter coffee than women, while both men and women showed almost the same preference for acidic beverage sweetness. The sex difference in preferences for coffee sweetness may be related to coffee-drinking habits.
Source : Percept Mot Skills 2007 vol.105 (2), pp 403 - 404 (not available on line)
Additive effects of flavour-caffeine and flavour-flavour pairings on liking for the smell and flavour of a novel drink
Yeomans, M. R.; Mobini, S.; Chambers, L.
Previous research has established that caffeine consumption can reinforce changes in liking for caffeine paired flavours, while pairing a novel flavour with a liked or dislike taste can also result in enduring changes in liking for the flavour. The present study examined how these two forms of flavour-learning interact. 72 habitual caffeine consumers who liked sweet tastes rated the odour and flavour of a novel tea drink before and after four training sessions where the flavour was paired with either 100 mg caffeine or placebo in one of three flavour contexts: added sweetness (aspartame), bitterness (quinine) or control. The liking for both the odour and flavour of the tea increased after pairing with caffeine regardless of flavour context, while pairing with bitterness reduced flavour liking regardless of the presence of caffeine. Pairing with quinine increased the rated bitterness of the tea odour, and reduced the rated sweetness of the tea flavour, post-training, independent of effects of caffeine. These data suggest that flavour-caffeine and flavour-flavour associations have additive effects on drink liking, while confirming that flavour-flavour associations can alter the immediate sensory experience of a flavour alone.
Source : Physiol Behav 2007 vol.92 (5), pp 831 - 839
Furan in food: headspace method and product survey
Zoller, O.; Sager, F.; Reinhard, H.
Headspace gas chromatography-mass spectrometry (GC-MS) has been adapted for the efficient determination of furan in foods. Levels of furan in various foods were measured in order to identify the products that contribute most to the human intake of furan. Highest amounts were found in products that were heat treated in sealed containers such as jarred and canned food products and in crusty and dry products such as snacks, biscuits, bread crust, roasted wheat flour and roasted coffee beans. Of the analysed jarred baby food products those containing only meat and starch from rice and corn had low levels of furan. In addition, the fruit products showed similar low levels. Clearly higher concentrations were found in the vegetable and vegetable-meat products. For the adult population coffee seems to be an important product with respect to furan intake. Coffee brews from espresso-type machines had considerably higher amounts of furan than other coffee brews. This type of coffee is considered by experts to have the best coffee aroma. It is assumed that for regular coffee consumers coffee is the most important source of furan intake.
Source : Food Addit Contam 2007 vol.24 Suppl 1 pp 91 - 107
COFFEE & HEALTH
Effect of caffeine ingestion on one-repetition maximum muscular strength
Astorino, T. A.; Rohmann, R. L.; Firth, K.
Multiple studies corroborate the ergogenic properties of caffeine (CAF) for endurance performance, yetfewer investigations document the efficacy of acute caffeine intake for intense, short-term exercise. Theaim of the study was to determine the ergogenic potential of caffeine during testing of muscular strength and endurance. Twenty-two resistance-trained men ingested CAF (6 mg/kg) or placebo (PL) 1 h preexercise in a randomized, double-blind crossover design. They refrained from caffeine intake and strenuous exercise 48 and 24 h, respectively, pre-visit. Initially, resting heart rate and blood pressure were obtained followed by one-repetition maximum (1-RM) testing on the barbell bench press and leg press. Upon determination of 1-RM, participants completed repetitions to failure at 60%1-RM. Heart rate, blood pressure, and rating of perceived exertion (RPE) were measured after the final repetition. Compared to PL, there was no effect (P > 0.05) of caffeine on muscular strength, as 1-RM bench press (116.4 +/- 23.6 kg vs. 114.9 +/- 22.8 kg) and leg press (410.6 +/- 92.4 kg vs. 394.8 +/- 95.4 kg) were similar. Total weight lifted during the 60% 1-RM trial was 11 and 12% higher for the bench press and leg press with caffeine compared to placebo, yet did not reach significance. RPE was similar at the end of resistance exercise with CAF vs. PL. Acute caffeine intake does not significantly alter muscular strength or endurance during intense bench press or leg press exercise, yet the practical importance of the increased muscular endurance remains to be explored.
Source : Eur J Appl Physiol 2008 vol.102 (2), pp 127 - 132
Adenosine A1-A2A receptor heteromers: new targets for caffeine in the brain
Ferre, S.; Ciruela, F.; Borycz, J.; Solinas, M.; Quarta, D.; Antoniou, K.; Quiroz, C.; Justinova, Z.; Lluis, C.; Franco, R.; Goldberg, S. R.
The contribution of blockade of adenosine A1 and A2A receptor to the psychostimulant effects of caffeine is still a matter of debate. When analyzing motor activity in rats, acutely administered caffeine shows a profile of a non-selective adenosine receptor antagonist, although with preferential A1 receptor antagonism. On the other hand, tolerance to the effects of A1 receptor blockade seems to be mostly responsible for the tolerance to the motor-activating effects of caffeine, while the residual motor-activating effects of caffeine in tolerant individuals seem to involve A2A receptor blockade. These behavioral studies correlate with in vivo microdialysis experiments that suggest that A1 receptor-mediated modulation of striatal glutamate release is involved in the psychostimulant effects of caffeine. Experiments in transfected cells demonstrate the ability of A1 receptors to heteromerize with A2A receptors and the A1-A2A receptor heteromer can be biochemically identified in the striatum, in striatal glutamatergic terminals. The striatal A1-A2A receptor heteromer provides a "concentration-dependent switch" mechanism by which low and high concentrations of synaptic adenosine produce the opposite effects on glutamate release. The analysis of the function of A1-A2A receptor heteromers during chronic treatment with caffeine gives new clues about the well-known phenomenon of tolerance to the psychostimulant effects of caffeine .
Source : Front Biosci 2008 vol.13 pp 2391 - 2399
Pharmacological and Psychological Effects of Caffeine Ingestion in 40-km Cycling Performance
Foad, A. J.; Beedie, C. J.; Coleman, D. A.
The ergogenic effects of caffeine are well documented. Research has yet to examine any psychological contribution to this effect. AIM:: To explore the psychological and pharmacological effects of caffeine in laboratory cycling performance. METHOD:: Fourteen male competitive cyclists performed 14 40-km time trials (eight experimental interspersed with six baseline). The experimental phase consisted of two trials for each of four experimental conditions: informed caffeine/received caffeine, informed no treatment/received caffeine, informed caffeine/received placebo, and informed no treatment/received no treatment. Conditions were nonrandomized. ANOVA was used to estimate main effects and interactions for mean values of power, heart rate, blood lactate, and maximal oxygen uptake. Probabilistic inferences for mean power were based on a smallest worthwhile change of 1.5%. RESULTS:: Relative to baseline, a very likely beneficial main effect of receiving caffeine (3.5%; 95% confidence interval 1.5 to 5.5%), and a possibly beneficial main effect of being informed of caffeine (0.7%; -0.7 to 2.1%) were observed. A substantial interaction between belief and pharmacology indicated that caffeine exerted a greater effect on performance in conditions when subjects were informed that they had not ingested it, whereas belief exerted a greater influence on performance in the absence of caffeine (2.6%; -0.7 to 5.9%). A possibly harmful negative placebo (nocebo) effect was observed when subjects were correctly informed that they had ingested no caffeine (-1.9%; -4.1 to 0.3%). No clinically significant changes relative to baseline were observed in mean heart rate. Clear and substantial increases in blood lactate were evident after receipt of caffeine. Data for mean oxygen uptake were unclear. CONCLUSION:: Our data support the ergogenic efficacy of caffeine but suggest that both positive and negative expectations impact performance.
Source : Med Sci Sports Exerc 2008 vol.40 (1), pp 158 - 165
Coffee, caffeine, and coronary heart disease
Cornelis, M. C.; El Sohemy, A.
This review summarizes and highlights recent advances in current knowledge of the relationship between coffee and caffeine consumption and risk of coronary heart disease. Potential mechanisms and genetic modifiers of this relationship are also discussed. RECENT FINDINGS: Studies examining the association between coffee consumption and coronary heart disease have been inconclusive. Coffee is a complex mixture of compounds that may have either beneficial or harmful effects on the cardiovascular system. Randomized controlled trials have confirmed the cholesterol-raising effect of diterpenes present in boiled coffee, which may contribute to the risk of coronary heart disease associated with unfiltered coffee consumption. A recent study examining the relationship between coffee and risk of myocardial infarction incorporated a genetic polymorphism associated with a slower rate of caffeine metabolism and provides strong evidence that caffeine also affects risk of coronary heart disease. Several studies have reported a protective effect of moderate coffee consumption, which suggests that coffee contains other compounds that may be beneficial. SUMMARY: Diterpenes present in unfiltered coffee and caffeine each appear to increase risk of coronary heart disease. A lower risk of coronary heart disease among moderate coffee drinkers might be due to antioxidants found in coffee.
Source : Curr Opin Clin Nutr Metab Care 2007 vol.10 (6), pp 745 - 751 (not available on line)
Does caffeine modulate verbal working memory processes? An fMRI study
Koppelstaetter, F.; Poeppel, T. D.; Siedentopf, C. M.; Ischebeck, A.; Verius, M.; Haala, I.; Mottaghy, F. M.; Rhomberg, P.; Golaszewski, S.; Gotwald, T.; Lorenz, I. H.; Kolbitsch, C.; Felber, S.; Krause, B. J.
To assess the effect of caffeine on the functional MRI signal during a 2-back verbal working memory task, we examined blood oxygenation level-dependent regional brain activity in 15 healthy right-handed males. The subjects, all moderate caffeine consumers, underwent two scanning sessions on a 1.5-T MRScanner separated by a 24- to 48-h interval. Each participant received either placebo or 100 mg caffeine 20 min prior to the performance of the working memory task in blinded crossover fashion. The study was implemented as a blocked-design. Analysis was performed using SPM2. In both conditions, the characteristic working memory network of frontoparietal cortical activation including the precuneus and the anterior cingulate could be shown. In comparison to placebo, caffeine caused an increased response in the bilateral medial frontopolar cortex (BA 10), extending to the right anterior cingulate cortex (BA 32). These results suggest that caffeine modulates neuronal activity as evidenced by fMRI signal changes in a network of brain areas associated with executive and attentional functions during working memory processes.
Source : Neuroimage 2008 vol.39 (1), pp 492 - 499
Caffeine-related genital skin pain
Markos, A. R.
Genital hyperesthesia is more recognized in women but may affect men. We report both a female and a male patient in whom caffeine intake was associated with genital hyperesthesia.
Source : J Low Genit Tract Dis 2008 vol.12 (1), pp 38 - 39
Timing of blood pressure measurement related to caffeine consumption
Mort, J. R.; Kruse, H. R.
OBJECTIVE: To determine whether patients should wait 30 minutes after caffeine consumption to have their blood pressure measured. DATA SOURCES: Literature was obtained by searching MEDLINE (1980-September 2007), International Pharmaceutical Abstracts (1980-September 2007), and the Cochrane Database of Systematic Reviews (1994-September 2007). Search terms included caffeine and blood pressure. Literature was also obtained from citations in relevant articles. STUDY SELECTION AND DATA EXTRACTION: Articles that examined caffeine's acute effect on blood pressure were reviewed, with additional focus on caffeine tolerance and hypertensive status. DATA SYNTHESIS: Caffeine appears to affect blood pressure through adenosine receptor inhibition and an increased release of select neurotransmitters. Caffeine levels peak 30-120 minutes after oral intake and caffeine's half-life is 3-6 hours. The effect of caffeine on blood pressure has been examined for decades, with variable results depending on factors such as population examined (eg, hypertensive status, physical stressors, age) and study design (eg, acute effects, chronic ingestion, retrospective epidemiologic review). Caffeine tolerance diminishes the acute effect of caffeine on blood pressure, and hypertensive individuals are more susceptible to blood pressure changes. Reviews of caffeine's acute effect on blood pressure indicate changes of 3-15 mm Hg systolic and 4-13 mm Hg diastolic. Typically, blood pressure changes occur within 30 minutes, peak in 1-2 hours, and may persist for more than 4 hours.
CONCLUSIONS: Having a patient abstain from caffeine for 30 minutes prior to blood pressure monitoring is not adequate to avoid caffeine's potential effects. An alternative approach to blood pressure monitoring would be to ask the patient about recent caffeine consumption and interpret the blood pressure reading based on this information. In addition, healthcare practitioners should provide education regarding caffeine's effects.
Source : Ann Pharmacother 2008 vol.42 (1), pp 105 - 110
Time for tea: mood, blood pressure and cognitive performance effects of caffeine and theanine administered alone and together
Rogers, P. J.; Smith, J. E.; Heatherley, S. V.; Pleydell-Pearce, C. W.
Although both contain behaviourally significant concentrations of caffeine, tea is commonly perceived to be a less stimulating drink than coffee. At least part of the explanation for this may be that theanine, which is present in tea but not coffee, has relaxing effects. There is also some evidence that theanine affects cognitive performance, and it has been found to reduce blood pressure in hypertensive rats. OBJECTIVES: To study the subjective, behavioural and blood pressure effects of theanine and caffeine administered alone and together, in doses relevant to the daily tea consumption of regular tea drinkers. MATERIALS AND METHODS: In a randomised, double-blind, placebo-controlled study, healthy adult participants (n = 48) received either 250-mg caffeine, 200-mg theanine, both or neither of these. They completed ratings of mood, including anxiety, and alertness, and had their blood pressure measured before and starting 40 min after drug administration. Anxiety was also assessed using a visual probe task. RESULTS: Caffeine increased self-rated alertness and jitteriness and blood pressure. Theanine antagonised the effect of caffeine on blood pressure but did not significantly affect jitteriness, alertness or other aspects of mood. Theanine also slowed overall reaction time on the visual probe task.
CONCLUSIONS: Theanine is a physiologically and behaviourally active compound and, while it is unclear how its effects might explain perceived differences between tea and coffee, evidence suggests that it may be useful for reducing raised blood pressure.
Source : Psychopharmacology (Berl) 2008 vol.195 (4), pp 569 - 577
Caffeine regulates alternative splicing in a subset of cancer-associated genes: a role for SC35
Shi, J.; Hu, Z.; Pabon, K.; Scotto, K. W.
Alternative splicing of pre-mRNA contributes significantly to human proteomic complexity, playing a key role in development, gene expression and, when aberrant, human disease onset. Many of the factors involved in alternative splicing have been identified, but little is known about their regulation. Here we report that caffeine regulates alternative splicing of a subset of cancer-associated genes, including the tumor suppressor KLF6. This regulation is at the level of splice site selection, occurs rapidly and reversibly, and is concentration dependent. We have recapitulated caffeine-induced alternative splicing of KLF6 using a cell-based minigene assay and identified a "caffeine response element" within the KLF6 intronic sequence. Significantly, a chimeric minigene splicing assay demonstrated that this caffeine response element is functional in a heterologous context; similar elements exist within close proximity to caffeine-regulated exons of other genes in the subset. Furthermore, the SR splicing factor, SC35, was shown to be required for induction of the alternatively spliced KLF6 transcript. Importantly, SC35 is markedly induced by caffeine, and overexpression of SC35 is sufficient to mimic the effect of caffeine on KLF6 alternative splicing. Taken together, our data implicate SC35 as a key player in caffeine-mediated splicing regulation. This novel effect of caffeine provides a valuable tool for dissecting the regulation of alternative splicing of a large gene subset and may have implications with respect to splice variants associated with disease states.
Source : Mol Cell Biol 2008 vol.28 (2), pp 883 - 895
Development and initial validation of a caffeine craving questionnaire
West, O.; Roderique-Davies, G.
Craving for caffeine has received little empirical attention, despite considerable research into the potential for caffeine dependence. The main aim of this study was to develop, and initially validate, a multi-item, multidimensional instrument to measure cravings for caffeine. Participants were 189 caffeine consumers who completed the Questionnaire of Caffeine Cravings, which was based on the Questionnaire of Smoking Urges (QSU), in one of five naturally occurring periods of abstinence; 1-15 min; 16-120 mins; 3-7 h; 12-48 h and +48 h. Exploratory factor analysis suggested a three-factor solution best described the data; Factor 1 reflected strong desires, intentions and positive reinforcement; Factor 2 reflected mild/general positive and negative reinforcement and Factor 3 reflected functional/mood-based negative reinforcement. Significantly higher Factor 1 and Factor 2 scores were recorded for high frequency users; significantly higher Factor 1 and Factor 3 scores were recorded as a function of increased levels of dependence. Duration of abstinence did not significantly effect cravings across all three factors. Regression analyses suggested level of dependence best predicted both current cravings and frequency of daily use. These findings suggest caffeine cravings may be conceptualized multidimensionally and further validates the use of multidimensional, multi-item instruments. Cravings for caffeine may manifest and be detected across varying levels of dependence and, frequency of use and independently of duration of abstinence.
Source : J Psychopharmacol 2008 vol.22 (1), pp 80 - 91
Daily coffee consumption and prevalence of nonmelanoma skin cancer in Caucasian women
Abel, E. L.; Hendrix, S. O.; McNeeley, S. G.; Johnson, K. C.; Rosenberg, C. A.; Mossavar-Rahmani, Y.; Vitolins, M.; Kruger, M.
The relationship between daily coffee consumption and nonmelanoma skin cancer was evaluated. This study was a cross-sectional analysis of women enrolled in the Women's Health Initiative observational Study (n = 93 676). As nearly all cases of self-reported nonmelanoma skin cancer occurred among Caucasian women (97.8%), analyses were focused on this group. Compared with nondrinkers, women drinking only caffeinated coffee on a daily basis had a 10.8% lower prevalence of nonmelanoma skin cancer. Consumption of <greater than or equal to>6 cups of caffeinated coffee per day was associated with a 36% reduction in nonmelanoma skin cancer. After adjusting for various demographic and life style variables, daily consumption of <greater than or equal to>6 cups was associated with a 30% reduced prevalence of nonmelanoma skin cancer. In contrast to caffeinated coffee, daily consumption of decaffeinated coffee was not associated with a significant change in self-reported nonmelanoma skin cancer for Caucasian women. It is concluded that daily caffeinated coffee consumption is associated with a dose-related decreased prevalence of nonmelanoma skin cancer in Caucasian women.
Source : Eur J Cancer Preven 2007 vol.16 (5), pp 446 - 452
More heartening news on the health front
Anon.
This paper looks at the health benefits of coffee and cocoa consumption. It is reported that cocoa and coffee protect against liver disease, colon cancer, gout, cellulite, chronic fatigue syndrome, and eyelid spasm, and enhances cognitive skills, antioxidant performance, memory and heart health. Various studies are detailed relating to these claims. It is also suggested that cocoa powder may be an effective natural alternative to fluoride in toothpaste.
Source : Coffee Cocoa Intern 2007 vol.34 (5), 24-27 (not available on line)
Caffeine-induced changes in cardiovascular function during resistance training
Astorino, T. A.; Rohmann, R. L.; Firth, K.; Kelly, S.
Caffeine (CAF) exerts a pressor effect both at rest and during exercise, as blood pressure is higher than with placebo. The effect of acute CAF ingestion combined with intense resistance training on cardiovascular function is unknown, however. The primary aim of the study was to examine changes in cardiovascular function after completion of fatiguing bench-press and leg-press exercise after CAF or placebo ingestion. Twenty-two resistance-trained men ingested CAF (6 mg/kg) or placebo 1 h preexercise in a randomized, double-blind crossover design. They refrained from CAF intake and strenuous exercise 48 and 24 h pretrial, respectively. Heart rate and blood pressure were measured preexercise. After a standardized warm-up, 1-repetition-maximum (1-RM) on the barbell bench press and leg press was tested. When it had been determined, a load equivalent to 60% of 1-RM was placed on the bar, and the subject completed repetitions to failure. Measurements of heart rate and blood pressure were immediately completed, and mean arterial pressure and rate-pressure product were calculated. Results showed significant (P < 0.05) increases in heart rate (+ 10 beats/min), systolic blood pressure (+ 8-10 mmHg), and rate-pressure product with acute CAF ingestion versus placebo. No change (P > 0.05) in diastolic blood pressure across time or treatment was shown. To prevent elevated blood pressure and potential enhanced risk of heart disease, CAF intake should be monitored in at-risk men who participate in resistance training.
Source : Int J Sport Nutr Exerc Metab 2007 vol.17 (5), pp 468 - 477
Caffeine effects on ERPs and performance in an auditory Go/NoGo task
Barry, R. J.; Johnstone, S. J.; Clarke, A. R.; Rushby, J. A.; Brown, C. R.; McKenzie, D. N.
Previous research has shown that caffeine produces a general increase in arousal. The present study examined caffeine-induced arousal effects on performance and auditory ERPs. We sought components showing amplitude changes without topography changes, as would be expected of a pure arousal amplification of source activity. METHODS: The effects of a single oral dose of caffeine (250mg) were examined in a randomised double-blind placebo-controlled repeated-measures cross-over study. Subjects abstained from caffeine for 4h before the testing sessions, which were conducted, in the afternoon, one week apart. A simple auditory Go/NoGo task was used, with a random mix of 75 tones at 1000Hz and 75 at 1500Hz. All tones were 60dB SPL, 50ms duration (rise/fall time 5ms), with SOA 1100ms. RESULTS: There was a reduction in RT, but no effects on omission or commission errors. The major ERP effects of caffeine were focal rather than global increases in P1, P2 and P3b amplitudes to Go stimuli, with no changes in latency. There were no effects on N1 or N2 to Go stimuli, and no effects on any components in response to NoGo stimuli.
CONCLUSIONS: The results suggest that caffeine differentially improves aspects of the processing related to response production and task performance, contrary to the widespread amplification of ERP component amplitudes, and latency reductions, expected of an increase in general arousal. SIGNIFICANCE: These results add auditory ERP data to the list of complex effects of caffeine on brain function and behaviour. They appear to rule out a simple arousal interpretation, and suggest directions for future research .
Source : Clin Neurophysiol 2007 vol.118 (12), pp 2692 - 2699
Caffeine\'s impairment of insulin-mediated glucose disposal cannot be solely attributed to adrenaline in humans
Battram, D. S.; Graham, T. E.; Dela, F.
Caffeine (CAF) impedes insulin-mediated glucose disposal (IMGD) and increases plasma adrenaline concentrations ([ADR]; 0.6 nm). While the antagonism of ADR abolishes the CAF effect, infusion of ADR (0.75 nm) has no effect on IMGD. We have now examined CAF and ADR in concert to determine whether or not they elicit an additive response on IMGD. We hypothesized that CAF + ADR would elicit a greater effect than either CAF or ADR alone (i.e. that CAF effects would not be solely attributed to ADR). Subjects (n = 8) completed four trials in a randomized manner. An isoglycaemic-hyperinsulinaemic clamp was performed 30 min after the following treatments were administered: (1) placebo capsules and saline infusion ([ADR] = 0.29 nm) (PL trial), (2) CAF capsules (dose = 5 mg kg(-1)) and saline infusion ([ADR] =0.62 nm) (CAF trial), (3) PL capsules and ADR infusion ([ADR] = 1.19 nm) (ADR trial), and (4) CAF capsules (dose = 5 mg kg(-1)) and ADR infusion ([ADR] = 0.93 nm) (CAF + ADR trial). As expected, CAF, ADR and CAF + ADR decreased (P <or= 0.05) IMGD compared to PL. CAF + ADR resulted in a more pronounced decrease in IMGD versus PL (42%) compared to CAF (26%) or ADR (24%) alone; however, the effect was not fully additive (P = 0.08). Furthermore, CAF decreased IMGD to a similar magnitude as ADR despite a 50% lower [ADR]. In summary, while ADR contributes to the CAF-induced impairment in IMGD, it is not solely responsible for caffeine's effects.
Source : J Physiol vol.583 (Pt 3), pp 1069 - 1077
Perception of simulated driving performance after sleep restriction and caffeine
Biggs, S. N.; Smith, A.; Dorrian, J.; Reid, K.; Dawson, D.; van den Heuvel, C.; Baulk, S.
As feelings of alertness are reported to be highly correlated with performance perception, the objective of this study was to determine whether caffeine, a common countermeasure to driver sleepiness, affected a sleepy driver's ability to monitor his or her simulated driving performance. METHODS: Twelve healthy young adults (six males, six females) participated in three counterbalanced, blinded, daytime conditions: control [9 h time in bed (TIB)], 100 mg caffeine (4 h TIB), and placebo (4 h TIB). Driving performance was measured through lane drift on a series of 30-min simulated driving sessions. Subjective sleepiness and perception of driving performance were measured at 5-min intervals during driving sessions via the Karolinska Sleepiness Scale and a corresponding perception scale. RESULTS: Sleep restriction had a significant detrimental effect on driving performance and subjective measures. Caffeine resulted in significant improvements across all measures. Subjective measures were found to be significantly correlated after sleep restriction and prior to caffeine. Correlations between actual and perceived performance were nonsignificant across all conditions.
CONCLUSIONS: The strong correlation between subjective measures supports the postulation that sleepiness is used as a cue for performance prediction when sleep restricted. The relationship between perceived and actual performance after fatigue countermeasures remains inconclusive. Further research, addressing limitations, is needed.
Source : J Psychosom Res 2007 vol.63 (6), pp 573 - 577 (not available on line)
Modulation of adenosine-induced responses in the guinea-pig trachea during long-term caffeine treatment: possible role of epithelium
Brugos, L.; Gesztelyi, R.; Zsuga, J.; Cseppento, A.; Benko, I.; Galajda, Z.; Deak, G.; Sipka, S.; Roszer, T.; Kovacs, P.; Szilasi, M.; Edes, I.; Szentmiklosi, A. J.
The responses to adenosine were studied on isolated, methacholine-precontracted tracheal strips of guinea pigs in the course of long-term caffeine or solvent treatment. Guinea pigs were fed caffeine for 10 weeks (average serum caffeine concentration: 39.1 +/- 3.9 microM). In epithelium-intact tracheal preparations (EITPs), sensititization to adenosine-induced relaxation (AIR) developed. It attained a maximum in week 1 of caffeine treatment, and then its level diminished and disappeared completely by weeks 4 - 6. In epithelium-denuded tracheal preparations (EDTPs), an increase in the sensitivity to adenosine was observed from week 1 to week 10 (a 4 - 6-fold reduction in EC50). Use of a coaxial bioassay system confirmed the role of epithelium in this process. The enhancement of the AIR of the EITPs was not modified by inhibitors of cyclooxygenase and lipoxygenase. Following depletion of the neuropeptides by acute capsaicin pretreatment, the AIR of the EITPs was strongly enhanced after caffeine treatment for 6 weeks. In chronically caffeine-treated EITPs, the inhibition of neutral endopeptidase led to dramatic reduction of the AIR. On the basis of the results by inhibiting nitric oxide synthase, it can be supposed that nitric oxide released from EITPs of long-lasting caffeine-treated animals operated as a constrictor agent. Our results show that chronic caffeine treatment gives rise to an initial sensitization to adenosine of the EITPs, this being followed by the development of a specific adaptive process in the epithelial cells, which counterbalances the increased tracheal sensitivity to adenosine.
Source : J Pharmacol Sci 2007 vol.105 (3), pp 279 - 290
Cooperative binding of acetaminophen and caffeine within the P450 3A4 active site
Cameron, M. D.; Wen, B.; Roberts, A. G.; Atkins, W. M.; Campbell, A. P.; Nelson, S. D.
Acetaminophen (N-acetyl-p-aminophenol, APAP) is a commonly used analgesic/antipyretic. When oxidized by P450, a toxic APAP metabolite is generated. Human P450 3A4 was expressed in Escherichia coli , purified, and reconstituted using artificial liposomes. Oxidation of APAP by P450 3A4, as detected by the formation of its glutathione adduct, was found to exhibit negative homotropic cooperativity with a Hill coefficient of 0.7. In the presence of caffeine, the observed kinetics were close to classical Michaelis-Menten kinetics with a Hill coefficient approaching 1. In order to probe for a potential repositioning of APAP within the P450 3A4 pocket in the presence of caffeine, NMR T1 paramagnetic relaxation techniques were used to calculate distances from the P450 3A4 heme iron to protons of APAP alone and in the presence of caffeine. Both APAP and caffeine were found to bind at the active site in proximity to the heme iron. When APAP was incubated with P450 3A4, the acetamido group of APAP was found to be closest to the heme iron consistent with the amide group of APAP weakly associating with the heme iron. The addition of caffeine disrupted the ability of APAP to coordinate with the heme iron of P450 3A4 and enhanced the rate of oxidation to its toxic metabolite.
Source : Chem Res Toxicol 2007 vol.20 (10), pp 1434 - 1441
Stimulatory effect of oral administration of tea, coffee or caffeine on UVB-induced apoptosis in the epidermis of SKH-1 mice
Conney, A. H.; Zhou, S.; Lee, M. J.; Xie, J. G.; Yang, C. S.; Lou, Y. R.; Lu, Y.
Oral administration of green tea or a caffeine solution, but not decaffeinated green tea, inhibits UVB induced complete carcinogenesis in SKH-1 mice. Oral administration of green tea, coffee or a caffeine solution for 2 weeks enhanced UVB-induced increases in apoptosis in the epidermis, but these treatments had no effect in non-UVB treated normal epidermis. Our results suggest that administration of green tea, coffee and caffeine may inhibit UVB-induced carcinogenesis--at least in part--by enhancing UVB-induced apoptosis. Plasma levels of caffeine observed after its oral administration at cancer-preventive dose levels were within the range observed in moderate coffee drinkers. Topical applications of caffeine to mic previously treated with UVB for 20 weeks (high risk mice without tumors) inhibited the formation of tumors and stimulated apoptosis in the tumors but not in areas of the epidermis away from tumors. The selective effects of caffeine administration to stimulate UVB-induced apoptosis or apoptosis in tumors but not in normal epidermis or in areas of the epidermis away from tumors is of considerable interest, but the reasons for the selective effects of caffeine on apoptosis in DNA damaged tissues are unknown. Further studies are needed to determine mechanisms of these effects of caffeine and to determine the effects of caffeine administration on sunlight-induced actinic keratoses and squamous cell carcinomas in humans.
Source : Toxicol Appl Pharmacol 2007 vol.224 (3), pp 209 - 213
Well-trained endurance athletes\' knowledge, insight, and experience of caffeine use
Desbrow, B.; Leveritt, M.
This descriptive cross-sectional study assessed the perceptions, knowledge, and experiences of caffeine use by athletes competing at the 2005 Ironman Triathlon World Championships. Questionnaires were distributed to 140 athletes (105 men and 35 women, 40.3 +/- 10.7 y old) representing 16 countries during prerace registration. A large proportion (73%) of these endurance athletes believe that caffeine is ergogenic to their endurance performance, and 84% believe it improves their concentration. The most commonly reported positive caffeine experiences related to in-competition use of cola drinks (65%) and caffeinated gels (24%). The athletes' ability to accurately quantify the caffeine content of common food items was limited. The most popular sources of caffeine information were self-experimentation (16%), fellow athletes (15%), magazines (13%), and journal articles (12%). Over half the athletes (53%) could not identify an amount of caffeine required to improve their triathlon performance. Mean (+/- standard deviation) suggested doses were 3.8 (+/- 3) mg/kg body weight. Few side effects associated with taking caffeine during exercise were reported.
Source : Int J Sport Nutr Exerc Metab 2007 vol.17 (4), pp 328 - 339
Transient inhibition of astrocytogenesis in developing mouse brain following postnatal caffeine exposure
Desfrere, L.; Olivier, P.; Schwendimann, L.; Verney, C.; Gressens, P.
Caffeine is frequently administered in human preterm newborns. Although some data suggest a potential risk for the developing brain, its impact has not been fully evaluated. We used a murine model of postnatal caffeine treatment in which mouse pups received intraperitoneal injections of caffeine from postnatal days 3 to 10. Caffeine exposure resulted in a transient reduction of glial fibrillary acidic protein and S100beta protein expression in various brain areas during the first 2 postnatal weeks (19.8% and 23.2% reduction in the hippocampus at P15, respectively). This effect was dose-dependent and at least partly involved a reduction of glial proliferation, as a caffeine-induced decrease of 5-bromodeoxyuridine incorporation was observed in the dentate gyrus and subventricular zone (25.8% and 26.6%, respectively) and no increase of programmed cell death (cleaved caspase-3 immunostaining) was observed at postnatal day 7. This effect could be reproduced with an antagonist of A(2a) adenosine receptor (A(2a)R) and was blocked by co-injection of an agonist. These results suggest that postnatal caffeine treatment might induce an alteration of astrocytogenesis via A(2a)R blockade during brain development. Although no obvious neuritic abnormalities (microtubule-associated protein 2 and synaptophysin immunostaining) were observed, postnatal caffeine treatment could have long-term consequences on brain function.
Source : Pediatr Res 2007 vol.62 (5), pp 604 - 609
Association of serum caffeine concentrations with serum glucose levels in caffeine-drug users and nonusers - results of German National Health Surveys
Du, Y.; Melchert, H. U.; Knopf, H.; Braemer-Hauth, M.; Pabel, E.
The purpose of this study was to explore the association of serum caffeine concentrations with serum glucose levels in caffeine-drug users and non-users, aiming at the chronic effects of caffeine on glucose metabolism in comparison with known acute effects of caffeine. Eight hundred and fourteen caffeine-drug users and 623 non-users were identified from German National Health Surveys. Their serum caffeine concentrations and glucose levels were measured. The associations of caffeine concentrations with glucose levels were established by correlation analysis and multivariable regression analysis in caffeine drug users and non-users separately. Antidiabetic therapy was considered. Caffeine concentrations were closely positively correlated to serum glucose levels in caffeine-drug users (Spearman r = 0.117, p = 0.001; partial r = 0.102, p = 0.020) particularly in women (Spearman r = 0.155, p < 0.001; partial r = 0.150, p = 0.005) although the correlation was weak as shown by multivariable regression analysis. The serum glucose levels were significantly higher (5.403 +/- 0.033 vs. 5.306 +/- 0.037 mmol/l) whereas the magnesium level was significantly lower (0.8941 +/- 0.0026 vs. 0.9024 +/- 0.0030 mmol/l) in caffeine-drug users than in non-users. No associations of caffeine concentrations with serum glucose levels were found in any groups of caffeine-drug non-users in our study. Whereas acute intake of caffeine-drugs may impair glucose metabolism, chronic intake of caffeine exclusively from diet has little effects on glucose metabolism and therefore may not contribute to the risk reduction of type 2 diabetes that was found in recent coffee consumption studies.
Source : Diabetes Obes Metab 2007 vol.9 (5), pp 756 - 758
Tea and coffee as the main sources of oxalate in diets of patients with kidney oxalate stones
Gasinska, A.; Gajewska, D.
We analyzed nutritional habits of 22 stone formers with special regard to oxalate content as one of the main nutritional lithogenic factors associated with kidney stones. Daily dietary oxalate intake was 354 +/-261 mg and 406 +/- 265 mg in men and women respectively. These values were much higher than those found by other researches. The main sources of oxalate in diets were regular tea and coffee (80-85%). Only 15-20% of oxalate was derived from other plant foods. Patients did not adhere to high fluid diet and, what is more, as common beverage they chose rich-oxalate black tea. Patients' daily intake of calcium was low and didn't exceed 520 mg. Vitamin C consumption was higher than Polish Dietary Reference Intake (DRI) and vitamin B6 lower than DRI. In the management of stone patients, to lower the risk of recurrence, appropriate diet (according to the type of stone) should be provided by dietitian.
Source : Rocz Panstw Zakl Hig 2007 vol.58 (1), pp 61 - 67 (not available on line)
Dietary fiber from coffee beverage: degradation by human fecal microbiota
Gniechwitz, D.; Reichardt, N.; Blaut, M.; Steinhart, H.; Bunzel, M.
Arabinogalactans and galactomannans from coffee beverages are part of the dietary fiber complex. Chemical structures and fermentability of soluble dietary fiber obtained from a standard filter coffee beverage (Coffea arabica, origin Colombia, medium roasted) by human intestinal bacteria were investigated. One cup (150 mL) of filter coffee contained approximately 0.5 g of soluble dietary fiber (enzymatic-gravimetric methodology), 62% of which were polysaccharides. The remainder was composed of Maillard reaction products and other nonidentified substances. Galactomannans and type II arabinogalactans were present in almost equal proportions. Coffee dietary fiber was readily fermented by human fecal slurries, resulting in the production of short-chain fatty acids (SCFA). After 24 h of fermentation, 85% of total carbohydrates were degraded. In general, arabinosyl units from the polysaccharide fraction were degraded at a slower rate than mannosyl and galactosyl units. In the process of depolymerization arabinogalactans were debranched and the ratio of (1-->3)-linked to (1-->6)-linked galactosyl residues decreased. Structural units composed of (1-->5)-linked arabinosyl residues were least degradable, whereas terminally linked arabinosyl residues were easily utilized. The impact of coffee fiber on numerically dominant population groups of the intestinal microbiota was investigated by fluorescence in situ hybridization combined with flow cytometry (FISH-FC). After 24 h of fermentation, an increase of about 60% of species belonging to the Bacteroides-Prevotella group was observed. The growth of bifidobacteria and lactobacilli was not stimulated.
Source : J Agric Food Chem 2007 vol.55 (17), pp 6989 - 6996
The effect of caffeine to increase reaction time in the rat during a test of attention is mediated through antagonism of adenosine A2A receptors
Higgins, G. A.; Grzelak, M. E.; Pond, A. J.; Cohen-Williams, M. E.; Hodgson, R. A.; Varty, G. B.
Caffeine produces effects on cognitive function particularly relating to aspects of attention such as reaction time. Considering the plasma exposure levels following regular caffeine intake, and the affinity of caffeine for known protein targets, these effects are likely mediated by either the adenosine A(1) or A(2A) receptor. In the present studies, two rat strains [Long-Evans (LE) and CD] were trained to asymptote performance in a test of selective attention, the 5-choice serial reaction time task (5-CSRTT). Next, the effects of caffeine were compared to the selective A(2A) antagonists, SCH 412348 and KW-6002 (Istradefylline), and the A(1) antagonist, DPCPX. Further studies compared the psychostimulant effects of each drug. Finally, we tested the A(2A) agonist, CGS-21680, on 5-CSRTT performance and given the antipsychotic potential of this drug class, studied the interaction between CGS-21680 and amphetamine in this task. Caffeine (3-10mg/kg IP) increased reaction time in both LE and CD rats, with no effect on accuracy, an effect replicated by SCH 412348 (0.1-1mg/kg PO) and KW-6002 (1-3mg/kg PO), but not DPCPX (3-30 mg/kg PO). At least with SCH 412348, these effects were at doses that were not overtly psychostimulant. In contrast, CGS-21680 (0.03-0. 3mg/kg IP) slowed reaction speed and increased omissions. Interestingly, at a comparatively low dose of 0.03 mg/kg, CGS-21680 attenuated the increased premature responding produced by amphetamine (1mg/kg IP). The present results suggest that the attention-enhancing effects of caffeine are mediated through A(2A) receptor blockade, and selective A(2A) receptor antagonists may have potential as therapies for attention-related disorders. Furthermore, the improvement in response control in amphetamine-treated rats following CGS-21680 pretreatment supports the view that A(2A) agonists have potential as novel antipsychotics.
Source : Behav Brain Res 2007 vol.185 (1), pp 32 - 42
Comparison of diet measures from a food-frequency questionnaire with measures from repeated 24-hour dietary recalls. The Norwegian Women and Cancer Study
Hjartaker, A.; Andersen, L. F.; Lund, E.
Diet measures from a food-frequency questionnaire (FFQ) were compared with measures from 24-h dietary recalls (24HDRs). Participants in Norway answered a FFQ after completing 4 repeated 24HDRs during 1 yr. Of 500 women randomly selected from The Norwegian Women and Cancer Study (the Norwegian arm of the European Prospective Investigation into Cancer and Nutrition), 286 agreed to participate and 238 completed the study. On the group level, the FFQ overestimated absolute intake in 7 and underestimated intake in 6 of 21 food groups. Intakes of energy, fat, added sugar and alcohol were lower in the FFQ than in the 24HDRs, whereas intake of fibre was higher. Spearman's rank correlation coeff. ranged from 0.13 (desserts) to 0.82 (coffee) for foods, and from 0.25 (beta-carotene) to 0.67 (alcohol) for nutrients. 3% of the observations on nutrient intake fell into the opposite quintile when classified according to the FFQ as compared with the 24HDR. The median calibration coeff., calculated by regression of the 24HDR data on the FFQ data, was 0.57 for foods and 0.38 for nutrients. The FFQ's ability to rank subjects was good for foods eaten frequently and fairly good for macronutrients in terms of energy percentages. Weaker ranking abilities were seen for foods eaten infrequently and for some micronutrients. These results underline the necessity of performing measurement error corrections.
Source : Public Health Nutr 2007 vol.10 (10), pp 1094 - 1103
Caffeine, sleep and wakefulness: implications of new understanding about withdrawal reversal
James, J. E.; Keane, M. A.
The broad aim of this review is to critically examine the implications of new understanding concerning caffeine withdrawal and withdrawal reversal in the context of research concerned with the effects of caffeine on sleep and wakefulness. A comprehensive search was conducted for relevant experimental studies in the PubMED and PsycINFO databases. Studies were assessed with particular reference to methodological adequacy for controlling against confounding due to caffeine withdrawal and withdrawal reversal. This assessment was used to clarify evidence of effects, highlight areas of ambiguity and derive recommendations for future research. It was found that researchers have generally failed to take account of the fact that habitual use of caffeine, even at moderate levels, leads to physical dependence evidenced by physiological, behavioural and subjective withdrawal effects during periods of abstinence. Consequently, there has been near-complete absence of adequate methodological controls against confounding due to reversal of withdrawal effects when caffeine is experimentally administered. The findings of what has been a substantial research effort to elucidate the effects of caffeine on sleep and wakefulness, undertaken over a period spanning decades, are ambiguous. Current shortcomings can be redressed by incorporating suitable controls in new experimental designs.
Source : Hum Psychopharmacol 2007 vol.22 (8), pp 549 - 558
Coffee and tea consumption and the risk of Parkinson\'s disease
Hu, G.; Bidel, S.; Jousilahti, P.; Antikainen, R.; Tuomilehto, J.
Several prospective studies have assessed the association between coffee consumption and Parkinson's disease (PD) risk, but the results are inconsistent. We examined the association of coffee and tea consumption with the risk of incident PD among 29,335 Finnish subjects aged 25 to 74 years without a history of PD at baseline. During a mean follow-up of 12.9 years, 102 men and 98 women developed an incident PD. The multivariate-adjusted (age, body mass index, systolic blood pressure, total cholesterol, education, leisure-time physical activity, smoking, alcohol and tea consumption, and history of diabetes) hazard ratios (HRs) of PD associated with the amount of coffee consumed daily (0, 1-4, and >/=5 cups) were 1.00, 0.55, and 0.41 (P for trend = 0.063) in men, 1.00, 0.50, and 0.39 (P for trend = 0.073) in women, and 1.00, 0.53, and 0.40 (P for trend = 0.005) in men and women combined (adjusted also for sex), respectively. In both sexes combined, the multivariate-adjusted HRs of PD for subjects drinking >/=3 cups of tea daily compared with tea nondrinkers was 0.41 (95% CI 0.20-0.83). These results suggest that coffee drinking is associated with a lower risk of PD. More tea drinking is associated with a lower risk of
PD. (c) 2007 Movement Disorder Society.
Source : Mov Disord 2007 vol.22 (15), pp 2242 - 2248
Green tea and coffee intake and risk of pancreatic cancer in a large-scale, population-based cohort study in Japan (JPHC study)
Juhua, Luo; Inoue, M.; Iwasaki, M.; Sasazuki, S.; Otani, T.; Weimin, Ye; Tsugane, S.
Pancreatic cancer is one of the most aggressive and treatment-refractory malignancies in humans. The most effective means of reducing pancreatic cancer mortality may be primary prevention. Although laboratory studies have demonstrated that green tea possesses anticancer activities, results from epidemiological studies have failed to show a consistent cancer-preventive effect. In addition, there is a lingering concern that coffee mighty increase the risk of pancreatic cancer although the most recent epidemiological studies showed no overall association between coffee and risk. Here, the association between the drinking of green tea or coffee and the risk of pancreatic cancer was examined in a large population-based cohort study in Japan (JPHC study). In total, 102 137 participants were followed for an average of 11 yr through to the end of 2003. A total of 233 incident cases of pancreatic cancer were identified among 1 116 945 person-years of follow-up. Overall, the risk of pancreatic cancer was not associated with either green tea or coffee intake in our population, although a reduced risk was apparent among men who drank <greater than or equal to>3 cups of coffee per day compared with those who did not drink any or only rarely drank coffee. In conclusion, these findings support the idea that green tea or coffee consumption does not have a substantial impact on pancreatic cancer risk in general.
Source : Eur J Cancer Prev 2007 vol.16 (6), pp 542 - 548
Caffeine-loaded niosomes: characterization and in vitro release studies
Khazaeli, P.; Pardakhty, A.; Shoorabi, H.
We prepared different neutral and positively charged niosomal formulations containing sorbitan esters for entrapment of caffeine. Drug entrapment reduced following the incorporation of positively charged molecule. Furthermore, the span 60-containing niosomes showed the highest drug encapsulation efficiency due to solid-state nature of this surfactant's bilayers. There was a regular relationship between lipophilicity (HLB values) of surfactants and mean particle sizes; increasing the HLB value resulted in larger niosomes. By means of diffusion experiments with Franz diffusion cells, the effects of different vesicular components and that of the positive charge on the release of caffeine from various vesicle formulations were studied. Obtained results indicate that a combined erosion-diffusion mechanism regulates the permeation of caffeine through cellulose acetate membranes. High encapsulation efficiency, appropriate size distribution, and good vesicular stability, especially in solid state niosomes, make this type of vesicular systems a good alternative to liposomes for topical delivery of caffeine .
Source : Drug Deliv 2007 vol.14 (7), pp 447 - 452
Caffeine effects on risky decision making after 75 hours of sleep deprivation
Killgore, W. D.; Lipizzi, E. L.; Kamimori, G. H.; Balkin, T. J.
Recent research indicates that sleep deprivation impairs decision making. However, it is unknown to what extent such deficits are exacerbated in a dose-response manner by increasing levels of sleepiness, and the extent to which such sleep-loss-induced deficits can be reversed by caffeine. METHODS: At three time points, 26 healthy subjects completed alternate forms of the Iowa Gambling Task (IGT): rested baseline, 51 h awake, and 75 h awake. Every 2 h each night, 12 volunteers also received 4 200-mg doses of caffeine, with the last dose occurring 3 h prior to the IGT. RESULTS: At baseline, volunteers readily learned to avoid disadvantageous high-risk card decks while progressively choosing more frequently from advantageous low-risk card decks. When sleep deprived, however, these same subjects showed impaired performance, choosing more frequently from the disadvantageous high risk card decks, particularly during the latter half of the game. Contrary to expectations, the severity of performance impairment did not increase significantly from 51 to 75 h of wakefulness, and caffeine had no significant effects on IGT performance during sleep deprivation.
DISCUSSION AND CONCLUSIONS: As a provisional extension of our previous study, these preliminary findings further suggest that the ability to integrate emotion with cognition to guide decision making, a capacity believed to be mediated by the ventromedial prefrontal cortex, may be particularly vulnerable to sleep loss. Moreover, these capacities may not be significantly improved by moderate doses of caffeine, suggesting that they may function separately from simple arousal and alertness systems.
Source : Aviat.Space Environ Med 2007 vol.78 (10), pp 957 - 962
Effect of cytochrome P450 (CYP) inducers on caffeine metabolism in the rat
Kot, M.; Daniel, W. A.
Our previous studies, carried out using rat cDNA-expressed cytochrome P450 (CYP) isoforms, liver microsomes and specific CYP inhibitors, showed that the 1-N- and 3-N-demethylation of caffeine at a therapeutic concentration was predominantly catalyzed by CYP1A2 and CYP2C, its 7-N-demethylation was governed by P450s of the CYP2C subfamily, while its 8-hydroxylation was specifically mediated by CYP1A2. The present study was aimed at corroborating the above-described results using another experimental model, i.e. a study of caffeine metabolism in the liver microsomes and specific CYP inducers. Animals received one of the following inducers: beta-naphthoflavone (100 mg/kg i.p. for 4 days), phenobarbital (10 mg/kg for 6 days or 100 mg/kg i.p. for 4 days), pregnenolone 16alpha-carbonitrile (100 mg/kg i.p. for 4 days) or 15% ethanol ( approximately 11 g/kg in drinking water for 6 days). Sixteen hours after the last dose of an inducer liver microsomes were prepared and the caffeine metabolism and CYP isoform activities (testosterone 2alpha-, 2beta-, 6beta-, 7alpha-, 16beta-hydroxylation and warfarin 7- hydroxylation) were investigated. beta-Naphthoflavone (mainly a CYP1A inducer and CYP2C11 inhibitor) potently accelerated the metabolism of caffeine, the effect on 7-N-demethylation being the weakest. Moreover, the influence of beta-naphthoflavone on caffeine metabolism was more potent at the substrate concentration of 100 microM than 800 microM, in particular in the case of 7-N-demethylation and 8- hydroxylation. Pregnenolone-16alpha-carbonitrile (mainly a CYP3A inducer and CYP2C11 inhibitor) moderately induced 8-hydroxylation only. Phenobarbital (an inducer of CYP2B and other CYPs and a CYP2C11 inhibitor) moderately stimulated the metabolism of caffeine, but practically did not affect 7-Ndemethylation. Ethanol (mainly a CYP2E1 inducer) modestly increased the rates of the N-demethylation reactions. The presently obtained data confirm the pivotal role of CYP1A2 in the metabolism of caffeine, as well as the involvement of CYP3A in the 8-hydroxylation of caffeine and that of CYP2C11 in its 7-demethylation.
Source : Pharmacol Rep 2007 vol.59 (3), pp 296 - 305
Caffeine metabolism during prolonged treatment of rats with antidepressant drugs
Kot, M.; Wojcikowski, J.; Daniel, W. A.
Our previous studies showed that some of the tested antidepressants (tricyclics, SSRIs, mirtazapine, nefazodone) directly inhibited the metabolism of caffeine when added in vitro to liver microsomes. The aim of the present study was to investigate a possible indirect effect of prolonged in vivo administration of these antidepressants on the rate of caffeine oxidative metabolism: 1-N-, 3-N- and 7-N-demethylation and 8-hydroxylation in rat liver. The reactions were studied in liver microsomes of rats treated intraperitoneally (ip) for one day or two weeks with pharmacological doses of the drugs (imipramine, amitriptyline, clomipramine, nefazodone at 10 mg/kg; desipramine, fluoxetine, sertraline at 5 mg/kg; mirtazapine at 3 mg/kg), in the absence of the antidepressants in vitro. One-day treatment with imipramine and amitriptyline decreased, while fluoxetine accelerated the metabolism of caffeine. Nefazodone stimulated 1-N-demethylation only. Fluoxetine given chronically increased exclusively 7-N-demethylation, while imipramine showed only such tendency. Sertraline and mirtazapine enhanced the rates of all caffeine oxidation pathways. We conclude that the tested antidepressant drugs may affect the metabolism of caffeine not only in a direct way (binding to the enzyme), but also indirectly via inducing CYP1A2 (sertraline and mirtazapine) and CYP2C isoforms (fluoxetine, sertraline, mirtazapine) after prolonged administration. In addition, the presented data provide further experimental evidence for the importance of the subfamily CYP2C for the 7-N-demethylation of caffeine in the rat.
Source : Pharmacol Rep 2007 vol.59 (6), pp 727 - 733
Intakes of coffee, tea, milk, soda and juice and renal cell cancer in a pooled analysis of 13 prospective
Lee, J. E.; Hunter, D. J.; Spiegelman, D.; Adami, H. O.; Bernstein, L.; van den Brandt, P. A.; Buring, J. E.; Cho, E.; English, D.; Folsom, A. R.; Freudenheim, J. L.; Gile, G. G.; Giovannucci, E.; Horn-Ross, P. L.; Leitzmann, M.; Marshall, J. R.; Mannisto, S.; McCullough, M. L.; Miller, A. B.; Parker, A. S.; Pietinen, P.; Rodriguez, C.; Rohan, T. E.; Schatzkin, A.; Schouten, L. J.; Willett, W. C.; Wolk, A.; Zhang, S. M.; Smith-Warner, S. A.
Specific beverage intake may be associated with the risk of renal cell cancer through a diluting effect of carcinogens, alterations of hormone levels, or other changes in the renal tubular environment, but few prospective studies have examined these associations. We evaluated the associations between coffee, tea, milk, soda and fruit and vegetable juice intakes and renal cell cancer risk in a pooled analysis of 13 prospective studies (530,469 women and 244,483 men). Participants completed a validated food frequency questionnaire at baseline. Using the primary data, the study-specific relative risks (RRs) were calculated and then pooled using a random effects model. A total of 1,478 incident renal cell cancer cases were identified during a follow-up of 7-20 years across studies. Coffee consumption was associated with a modestly lower risk of renal cell cancer (pooled multivariate RR for 3 or more 8 oz (237 ml) cups/day versus less than one 8 oz (237 ml) cup/day = 0.84; 95% CI = 0.67-1.05; p value, test for trend = 0.22). Tea consumption was also inversely associated with renal cell cancer risk (pooled multivariate RR for 1 or more 8 oz (237 ml) cups/day versus non drinkers = 0.85; 95% CI = 0.71-1.02; pvalue, test for trend =0.04). No clear associations were observed for milk, soda or juice. Our findings provide strong evidence that neither coffee nor tea consumption increases renal cell cancer risk. Instead, greater consumption of coffee and tea may be associated with a lower risk of renal cell cancer.
Source : Int J Cancer 2007 vol.121 (10), pp 2246 - 2253
Hepatoprotective and antioxidant effects of the coffee diterpenes kahweol and cafestol on carbon tetrachloride-induced liver damage in mice
Lee, K. J.; Choi, J. H.; Jeong, H. G.
The hepatoprotective effects of kahweol and cafestol, coffee-specific diterpenes, on the carbon tetrachloride (CCl(4))-induced liver damage as well as the possible mechanisms involved in these protections were investigated. Pretreatment with kahweol and cafestol prior to the administration of CCl(4) significantly prevented the increase in the serum levels of hepatic enzyme markers (alanine aminotransferase and aspartate aminotransferase) and reduced oxidative stress, such as reduced glutathione content and lipid peroxidation, in the liver in a dose-dependent manner. The histopathological evaluation of the livers also revealed that kahweol and cafestol reduced the incidence of liver lesions induced by CCl(4). Treatment of the mice with kahweol and cafestol also resulted in a significant decrease in the cytochrome P450 2E1 (CYP2E1), the major isozyme involved in CCl(4) bioactivation, specific enzyme activities, such as p-nitrophenol and aniline hydroxylation. Kahweol and cafestol exhibited antioxidant effects on FeCl(2)-ascorbate induced lipid peroxidation in a mouse liver homogenate, and on superoxide radical scavenging activity. These results suggest that the protective effects of kahweol and cafestol against the CCl(4)-induced hepatotoxicity possibly involve mechanisms related to their ability to block the CYP2E1-mediated CCl(4) bioactivation and free radical scavenging effects.
Source : Food Chem Toxicol 2007 vol.45 (11), pp 2118 - 2125
La consommation reguliere de cafe reduirait le risque de diabete de type 2. [Does coffee protect against
Legrand, D.; Scheen, A. J.
The prevention of type 2 diabetes has become a major public health objective. Cross-sectional studies have shown a lower prevalence of type 2 diabetes among coffee drinkers. The present article synthesizes results of recent prospective studies, which assessed the relative risk of developing type 2 diabetes according to coffee consumption. Most studies confirm a protective effect against type 2 diabetes, with some dose-response in function of the degree of daily coffee consumption. The observed effect is rather impressive (relative risk reduced to almost 0.70-0.40) and is present whatever the type of population. It appears equal, or event greater, with decaffeinated coffee as compared to regular coffee. These results suggest that the protective effect could not be attributed exclusively to caffeine, but rather that it should be explained by other components, most probably chlorogenic acid and/or various anti-oxidants. The precise mechanism explaining the protection of coffee against type 2 diabetes and its potential relevance in public health remain to be specified.
Source : Rev Med Liege 2007 vol.62 (9), pp 554 - 559
Imbalance between CaM kinase II and calcineurin activities impairs caffeine-induced calcium release in hypertrophic cardiomyocytes
Lu, Y. M.; Shioda, N.; Han, F.; Moriguchi, S.; Kasahara, J.; Shirasaki, Y.; Qin, Z. H.; Fukunaga, K.
Cardiac hypertrophy impairs Ca(2+) handling in the sarcoplasmic reticulum, thereby impairing cardiac contraction. To identify the mechanisms underlying impaired Ca(2+) release from the sarcoplasmic reticulum in hypertrophic cardiomyocytes, we assessed Ca(2+)-dependent signaling and the phosphorylation of phospholamban, which regulates Ca(2+) uptake during myocardial relaxation and is in turn regulated by Ca(2+)/calmodulin-dependent protein kinase II (CaMKII) and calcineurin. In cultured rat cardiomyocytes, treatment with endothelin-1, angiotensin II, and phenylephrine-induced hypertrophy and increased CaMKII autophosphorylation and calcineurin expression. The calcineurin level reached its maximum at 72h and remained elevated for at least 96h after endothelin-1 or angiotensin II treatment. By contrast, CaMKII autophosphorylation, phospholamban phosphorylation, and caffeine-induced Ca(2+) mobilization all peaked 48h after these treatments. By 96h after treatment, CaMKII autophosphorylation and phospholamban phosphorylation had returned to baseline, and caffeine-induced Ca(2+) mobilization was impaired relative to baseline. A similar biphasic change was observed in dystrophin levels in endothelin-1-induced hypertrophic cardiomyocytes, and treatment with the novel CaM antagonists DY-9760e and DY-9836 significantly inhibited the hypertrophy-induced dystrophin breakdown. Taken together, the abnormal Ca(2+) regulation in cardiomyocytes following hypertrophy is in part mediated by an imbalance in calcineurin and CaMKII activities, which leads to abnormal phospholamban activity.
Source : Biochem Pharmacol 2007 vol.74 (12), pp 1727 - 1737
Low doses of caffeine reduce heart rate during submaximal cycle ergometry
McClaran, S. R.; Wetter, T. J.
The purpose of this study was to examine the cardiovascular effects of two low-levels of caffeine ingestion in non habitual caffeine users at various submaximal and maximal exercise ntensities. METHODS: Nine male subjects (19-25 yr; 83.3 +/- 3.1 kg; 184 +/- 2 cm), underwent three testing sessions administered in a randomized and double-blind fashion. During each session, subjects were provided 4 oz of water and a gelatin capsule containing a placebo, 1.5 mg/kg caffeine, or 3.0 mg/kg caffeine. After thirty minutes of rest, a warm-up (30 Watts for 2 min) the pedal rate of 60 rpm was maintained at a steady-state output of 60 watts for five minutes; increased to 120 watts for five minutes and to 180 watts for five minutes. After a 2 min rest the workload was 180 watts for one minute and increased by 30 watts every minute until exhaustion. Heart rate (HR) was measured during the last 15-seconds of each minute of submaximal exercise. Systolic blood pressure (BP) was measured at rest and during each of the three sub-maximal steady state power outputs. Minute ventilation (VE), Tidal volume (VT), Breathing frequency (Bf), Rating of perceived exertion (RPE), Respiratory exchange ratio (RER), and Oxygen consumption (VO2) were measured at rest and during each minute of exercise. RESULTS: affeine at 1.5 and 3.0 mg/kg body weight significantly lowered (p < 0.05) HR during all three submaximal exercise intensities compared to placebo (range - 4 to 7 bpm lower) but not at rest or maximal exercise. BP was significantly higher (p < 0.05) at rest and after the 3 mg/kg caffeine vs placebo (116 +/- 13 vs 123 +/- 10 mm Hg). Neither dose of caffeine had any effect on BP during submaximal exercise. Caffeine had no effect on VE, VT, VO2, RPE, maximal power output or time to exhaustion. CONCLUSION: In non habitual caffeine users it appears that consuming a caffeine pill (1.5 & 3.0 mg/kg) at a dose comparable to 1-3 cups of coffee lowers heart rate during submaximal exercise but not at near maximal and maximal exercise. In addition, this caffeine dose also only appears to affect systolic blood pressure at rest but not during cycling exercise.
Source : J Int Soc Sports Nutr 2007 vol.4, pp 11
Coffee and smoking as risk factors of twin pregnancies: the Danish National Birth Cohort
Morales-Suarez-Varela, M. M.; Bech, B. H.; Christensen, K.; Olsen, J.
Twinning rates have changed substantially over time for reasons that are only partly known. In this study we studied smoking, coffee and alcohol intake, and their possible interaction with obesity as potential determinants of twinning rates using data from the Danish National Birth Cohort between 1996 and 2002. We identified 82,985 pregnancies: 81,954 singleton and 1031 twins. For the twins we had data to classify 121 as monozygotic, 189 dizygotic (same sex), 313 dizygotic (opposite sex) but, 408 were of the same sex but with unknown zygosity. All mothers were interviewed about their prepregnancy weight and height, coffee and alcohol intake, smoking habits, and potential confounding factors at early stages of pregnancy. We identified smoking (> 10 cigarettes/day) as a possible determinant of twinning, particularly for dizygotic twinning rates (same sex) and furthermore corroborated that obesity and the mother's age are strong correlates of twinning. Others have found coffee intake to increase twinning rates but that is not seen in these data.
Source : Twin Res Hum Genet 2007 vol.10 (4), pp 597 - 603 (not available on line)
The safety of caffeine consumption
Muncie, H. L.
Should family physicians discourage, encourage, or ignore their patients' caffeine intake? After years of investigation and concern over caffeine's adverse effects, there is evidence that caffeine in moderate amounts is not harmful and may have some health benefits. (for details click on publications link)
Source : Am Fam Physician 2007 vol.76 (9), pp 1282-1285
Coffee drinking induces incorporation of phenolic acids into LDL and increases the resistance of LDL to ex vivo oxidation in humans
Natella, F.; Nardini, M.; Belelli, F.; Scaccini, C.
Epidemiologic and intervention studies indicate that both diet as a whole and single dietary components are involved in the risk of atherosclerosis. The resistance of LDL to oxidative modification is an ex vivo indicator of risk, which is modulated by dietary components. Coffee contains phenolic compounds with antioxidant activity. These molecules are found in plasma after the consumption of coffee, and it has been shown that, in vitro, they are able to decrease the susceptibility of LDL to oxidation. OBJECTIVE: The aim of this study was to evaluate the effect of coffee consumption on the redox status of LDL as modulated by the possible incorporation of phenolic acids into LDL. DESIGN: Ten healthy volunteers, after an overnight fast, drank 200 mL filtered coffee. Blood was drawn before and 30 and 60 min after drinking. Changes in LDL redox status were evaluated by the measure of LDL resistance to oxidative modification and the concentration of LDL(-), a mildly modified, electronegative LDL subfraction. Chlorogenic and phenolic acids concentration in LDL were measured by electrochemical HPLC. RESULTS: The resistance of LDL to oxidative modification increased significantly after coffee drinking, but the LDL(-) concentration did not increase. The concentration into LDL of conjugated forms of caffeic, p-coumaric, and ferulic acids increased significantly after coffee drinking. CONCLUSION: Drinking 200 mL (1 cup) coffee induces an increase in the resistance of LDL to oxidative modification, probably as a result of the incorporation of coffee's phenolic acids into LDL.
Source : Amer J Clin Nutr 2007 vol.86 (3), pp 604 - 609
1,3,7-trimethylxanthine (caffeine) may exacerbate acute inflammatory liver injury by weakening the physiological immunosuppressive mechanism
Ohta, A.; Lukashev, D.; Jackson, E. K.; Fredholm, B. B.; Sitkovsky, M.
The genetic elimination of A2A adenosine receptors (A2AR) was shown to disengage the critical
immunosuppressive mechanism and cause the dramatic exacerbation of acute inflammatory tissue
damage by T cells and myeloid cells. This prompted the evaluation of the proinflammatory vs the anti-inflammatory effects of the widely consumed behavioral drug caffeine, as the psychoactive effects of
caffeine are mediated largely by its antagonistic action on A2AR in the brain. Because caffeine has other
biochemical targets besides A2AR, it was important to test whether the consumption of caffeine during an acute inflammation episode would lead to the exacerbation of immune-mediated tissue damage. We
examined acute and chronic treatment with caffeine for its effects on acute liver inflammation. It is shown
that caffeine at lower doses (10 and 20 mg/kg) strongly exacerbated acute liver damage and increased
levels of proinflammatory cytokines. Because caffeine did not enhance liver damage in A2AR-deficient
mice, we suggest that the potentiation of liver inflammation was mediated by interference with the A2ARmediated tissue-protecting mechanism. In contrast, a high dose of caffeine (100 mg/kg) completely
blocked both liver damage and proinflammatory cytokine responses through an A2AR-independent
mechanism. Furthermore, caffeine administration exacerbated liver damage even when mice consumed
caffeine chronically, although the extent of exacerbation was less than in "naive" mice that did not
consume caffeine before. This study suggests an unappreciated "man-made" immunological
pathogenesis whereby consumption of the food-, beverage-, and medication-derived adenosine receptor
antagonists may modify an individual's inflammatory status and lead to excessive organ damage during
acute inflammation.
Source : J Immunol 2007 vol.179 (11), pp 7431 - 7438
[Pharmacological bases of coffee nutrients for diabetes prevention]
Oka, K.
With an increasing number of studies describing the negative correlation of coffee consumption and the risk for type 2 diabetes mellitus, we were compelled to elucidate the nutrients which bring pharmacological effects on risk reduction for diabetes. In this review, the author's interest is focused on chlorogenic and caffeic acids derived from lightly roasted coffee beans, as well as nicotinic acid, volatile Maillard reaction products (vMRPs), and another structurally unknown compound contained in heavily roasted beans. Caffeine is a common compound in both lightly and heavily roasted beans and its anti-inflammatory effects on degenerative diseases such as diabetes mellitus has been reevaluated recently. The prophylactic effects of coffee on diabetes involve pleiotropy of plural components in accordance to the degree of the roasting. A new concept of nutritional blended coffee may be important to optimize the prophylactic effects of coffee on lowering the risk factors of diabetes and delaying the progress of diabetes complications as well.
Source : Yakugaku Zasshi 2007 vol.127 (11), pp 1825 - 1836
Night-time thoughts in high and low worriers: reaction to caffeine-induced sleeplessness
Omvik, S.; Pallesen, S.; Bjorvatn, B.; Thayer, J.; Nordhus, I. H.
There is ample evidence for the existence of an association between sleeplessness and worry. Not much is known, however, concerning the nature of this relationship. Therefore, a study was conducted investigating the causal relationship between sleeplessness and nocturnal worry. A 2 x 2 (Worry x Induced sleeplessness) analysis of covariance design was used. The first factor consisted of a subject variable defined by scoring either high or low on a trait measure of worry (the Penn State Worry Questionnaire) and the second factor consisted of 300 mg caffeine or placebo. A total of 96 female undergraduate students participated. The dependent variables comprised measures of nocturnal worry (the Night-Time Thoughts Questionnaire) and subjective and objective sleep parameters. Overall, caffeine caused an increase in nocturnal worry and sleeplessness. A significant interaction effect occurred between Worry and Induced sleeplessness on one of the objective sleep parameters, but no other interaction effects were significant. The results suggest that worry may occur as an epiphenomenon of sleeplessness.
Source : Behav Res Ther 2007 vol.45 (4), pp 715 - 727
Consumo de cafeina entre gestantes e a prevalencia do baixo peso ao nascer e da prematuridade: uma
Pacheco, A. H.; Barreiros, N. S.; Santos, I. S.; Kac, G.
This article reports on a systematic review of studies on caffeine intake during pregnancy and prevalence of low birth weight and prematurity, focusing on methods to quantify intake and control for confounding. The review consisted of an article search from 1996 to 2006 in MEDLINE, LILACS, and PubMed, using the key words: "caffeine", "coffee", "low birth weight", "birth weight", "preterm", "premature", and "prematurity". Ten articles were selected. Methods used to quantify caffeine consumption were: semiquantitative food frequency questionnaires for diet or only caffeinated products, including one self-applied questionnaire; food recall; questions on type and method of preparation; analysis of samples; and urine and plasma caffeine levels. In three studies, high caffeine consumption was associated with low birth weight and/or prematurity. Contradictions between studies may be due to difficulties in measuring caffeine consumption; assessment of different caffeine sources; variations in the mode of preparation and amount consumed; and sample size. Association between moderate caffeine consumption and fetal growth was not demonstrated, so a more precise measurement of caffeine intake is necessary.
Source : Cad.Saude Publica 2007 vol.23 (12), pp 2807 - 2819
Coffee and hepatocellular carcinoma: Cause or confounding?
Patil, P. S.; Mallath, M. K.
No abstract
Source: Hepatology 2007 vol.46 (6), pp 2046 - 2047
Influence of caffeine ingestion on perceived mood states, concentration, and arousal levels during a 75-min university lecture
Peeling, P.; Dawson, B.
This investigation aimed to assess the effect of a caffeine supplement on perceived mood state, concentration, and arousal during a 75-min university lecture. Methods. This randomized, blind, crossover design investigation ran over a course of 2 consecutive weeks. During week 1, 10 third-year Human Movement and Exercise Science students were assigned to either a caffeine- or placebo-supplemented group and were subsequently required to attend a 75-min exercise rehabilitation lecture. Seven days later, students were assigned to the opposite supplementation group before attending a second follow-on lecture, equal in duration to that of week 1. At the conclusion of each lecture, students were required to complete a mood perception questionnaire to assess the perceived level of mood state, concentration, and arousal during the lecture. The results showed that after caffeine consumption, students perceived themselves to be significantly more awake, clear minded, energetic, alert, and anxious (P < 0.05). Additionally, students also felt they were better able to concentrate and had a greater level of arousal than when the placebo was consumed (P < 0.05). In conclusion, the results of this investigation show that university students report enhanced perceptual feelings of behavior and mood state when a low dose of caffeine is consumed 60 min prior to a 75-min academic lecture.
Source : Adv Physiol Educ 2007 vol.31 (4), pp 332 - 335
Effects of chronic coffee consumption on glucose kinetics in the conscious rat
Shearer, J.; Sellars, E. A.; Farah, A.; Graham, T. E.; Wasserman, D. H.
Epidemiological studies indicate that regular coffee consumption reduces the risk of developing type 2 diabetes. Despite these findings, the biological mechanisms by which coffee consumption exerts these effects are unknown. The aim of this study was twofold: to develop a rat model that would further delineate the effects of regular coffee consumption on glucose kinetics, and to determine whether coffee, with or without caffeine, alters the actions of insulin on glucose kinetics in vivo. Male Sprague-Dawley rats were fed a high-fat diet for 4 weeks in combination with one of the following: (i) drinking water as placebo (PL), (ii) decaffeinated coffee (2 g/100 mL) (DC), or (iii) alkaloid caffeine (20 mg/100 mL) added to decaffeinated coffee (2 g/100 mL) (CAF). Catheters were chronically implanted in a carotid artery and jugular vein for sampling and infusions, respectively. Recovered animals (5 days postoperative) were fasted for 5 h before hyperinsulinemic-euglycemic clamps (2 mU x kg(-1) x min(-1)). Glucose was clamped at 6 mmol/L and isotopes (2-deoxy-[(14)C]glucose and [3-(3)H]glucose) were administered to obtain indices of whole-body and tissue-specific glucose kinetics. Glucose infusion rates and measures of whole-body metabolic clearance were greater in DC than in PL or CAF, indicating increased whole-body insulin sensitivity. As the only difference between DC and CAF was the addition of alkaloid caffeine, it can be concluded that caffeine antagonizes the beneficial effects of DC. Given these findings, decaffeinated coffee may represent a nutritional means of combating insulin resistance.
Source : Can J Physiol Pharmacol 2007 vol.85 (8), pp 823 - 830
Coffee consumption and risk of cardiovascular events after acute myocardial infarction: results from the GISSI (Gruppo Italiano per lo Studio della Sopravvivenza nell\'Infarto miocardico)-Prevenzione trial
Silletta, M. G.; Marfisi, R.; Levantesi, G.; Boccanelli, A.; Chieffo, C.; Franzosi, M.; Geraci, E.; Maggioni, A. P.; Nicolosi, G.; Schweiger, C.; Tavazzi, L.; Tognoni, G.; Marchioli, R.
: The relation between coffee consumption and cardiovascular disease has been studied extensively, but results are still debated. In addition, little evidence is available on patients with established coronary heart disease. METHODS AND RESULTS: Prospectively ascertained information among 11,231 Italian patients (9584 males and 1647 females) with recent (< or = 3 months) myocardial infarction enrolled in the GISSI (Gruppo Italiano per lo Studio della Sopravvivenza nell'Infarto miocardico)-Prevenzione trial was used. Usual dietary habits were assessed at baseline and updated at 0.5 and 1.5 years. Coffee consumption was categorized as never/almost never, < 2 cups per day, 2 to 4 cups per day, and > 4 cups per day. Medication use and fasting glucose were assessed at 0.5, 1, 1.5, 2.5, and 3.5 years. Risk was evaluated with Cox proportional hazards with time-varying covariates. The main outcome measure was the cumulative incidence of cardiovascular events (cardiovascular death, nonfatal myocardial infarction, and nonfatal stroke). A total of 1167 cardiovascular events occurred during 36,961 person-years of follow-up. After multivariable adjustment for potential confounders in the time-dependent analysis, the relative risk of cardiovascular events across categories of coffee consumption was 1.02 (95% CI 0.87 to 1.20) for < 2 cups per day, 0.91 (95% CI 0.75 to 1.09) for 2 to 4 cups per day, and 0.88 (95% CI 0.64 to 1.20) for > 4 cups per day compared with abstainers (P for trend=0.18). Ultimately, coffee consumption did not change the risk of coronary heart disease events, stroke, and sudden death.
CONCLUSIONS: No association between moderate coffee intake and cardiovascular events was observed in post-myocardial infarction patients.
Source : Circulation 2007 vol.116 (25), pp 2944 - 2951
Tea and coffee drinking and ovarian cancer risk: results from the Netherlands Cohort Study and a metaanalysis
Steevens, J.; Schouten, L. J.; Verhage, B. A.; Goldbohm, R. A.; van den Brandt, P. A.
In a cohort study, ovarian cancer (280 cases) showed no significant association with tea or coffee, the multivariable rate ratios being 0.94 (95% confidence interval (CI): 0.89, 1.00) and 1.04 (95% CI: 0.97, 1.12) per cup per day, respectively. A meta-analysis also produced no significant findings overall, though the cohort studies showed a significant inverse association for tea.
Source : Br J Cancer 2007 vol.97 (9), pp 1291 - 1294
Chlorogenic acid in coffee can prevent the formation of dinitrogen trioxide by scavenging nitrogen dioxide generated in the human oral cavity
Takahama, U.; Ryu, K.; Hirota, S.
Coffee contains antioxidants like chlorogenic acid and its isomers. In this study, effects of coffee upon nitrite-induced N2O3 formation were investigated using whole saliva and a bacterial fraction prepared from saliva. The formation of N2O3 was measured by fluorescence increase due to the transformation of 4,5-diaminofluorescein to triazolfluorescein. Coffee inhibited the nitrite-induced fluorescence increase, and 50% inhibition was observed at several mug of coffee/ml in the bacterial fraction of saliva, as well as whole saliva. During the inhibition of the fluorescence increase, concn. of chlorogenic acid and its isomers decreased. It is suggested that the reduction of NO2 by chlorogenic acid and its isomers may have contributed to the coffee-dependent inhibition of the fluorescence increase as N2O3 is formed from NO and NO2. When coffee was added to whole saliva, chlorogenic acid and its isomers bound to cells in the saliva. The rate of the fluorescence increase in the bacterial fraction, which was prepared at defined periods after the ingestion of coffee, was increased to the rate before the ingestion of coffee with a halftime of approx. 1 h. This result suggests that chlorogenic acid and its isomers remain in the oral cavity for a few hours after ingestion of coffee. The significance of coffee drinking and rinsing of the mouth with coffee for the health of the oral cavity is discussed.
Source : J Agri Food Chem 2007 vol.55 (22), pp 9251 - 9258
Association between caffeine intake and risk of Parkinson\'s disease among fast and slow metabolizers
Tan, E. K.; Chua, E.; Fook-Chong, S. M.; Teo, Y. Y.; Yuen, Y.; Tan, L.; Zhao, Y.
Cytochrome P450 1A2 (CYP 1A2) is responsible for more than 90% of caffeine clearance. A polymorphic variant of CYP1A2 (-163C>A) (rs762551) is associated with high CYP1A2 inducibility. Both caffeine and its main metabolite, paraxanthine, may be neuroprotective. The association between caffeine intake and risk of Parkinson's disease (PD) in fast and slow caffeine metabolizers has not been compared. OBJECTIVE: In a case-control study, we analyzed the relationship between caffeine intake and risk of PD in both fast and slow caffeine metabolizers. METHODS: All the study participants were recruited prospectively, and interviewed for information on the amount and duration of caffeine intake. Genotyping of the CYP1A2 variant was carried out using the allelic discrimination method. RESULTS: Out of 1000 participants who were initially screened, 886 consisting of 418 PD and 468 race, sex and age matched controls were included. No evidence existed to suggest any association between CYP1A2 and the onset of PD (P=0.08). A significant association was seen between caffeine intake and the onset of PD (P=2.01x10(-5)), with the odds ratio for moderate and high drinkers at 0.71 [95% confidence interval (CI): 0.50-1.00] and 0.47 (95% CI: 0.34-0.65), respectively against the low drinkers. Multivariate analysis revealed no evidence of any interaction effects of caffeine with CYP1A2 (P=0.956). CONCLUSION: The association between caffeine intake and risk of PD was similarly observed in both fast and slow caffeine metabolizers, supporting experimental evidence in animal models that both caffeine and its major metabolite, paraxanthine, are neuroprotective.
Source : Pharmacogenet Genomics 2007 vol.17 (11), pp 1001 - 1005
The Effect of Chlorogenic Acid Enriched Coffee on Glucose Absorption in Healthy Volunteers and Its Effect on Body Mass When Used Long-term in Overweight and Obese People
Thom, E.
The results from a clinical study performed in 12 healthy volunteers with different coffee products containing glucose show that instant coffee enriched with chlorogenic acid induced a reduction in the absorption of glucose of 6.9% compared with the control. No such effects were seen with normal or decaffeinated instant coffee. In a second, comparative, randomized, double-blind, 12-week study we investigated the effect on the body mass of 30 overweight people, compared with normal instant coffee. The average losses in mass in the chlorogenic acid enriched and normal instant coffee groups were 5.4 and 1.7 kg, respectively. We conclude that chlorogenic acid enriched instant coffee appears to have a significant effect on the absorption and utilization of glucose from the diet. This effect, if the coffee is used for an extended time, may result in reduced body mass and body fat when compared with the use of normal instant coffee.
Source : J Int Med Res 2007 vol.35 (6), pp 900 - 908
Early renal injury induced by caffeine consumption in obese, diabetic ZSF1 rats
Tofovic, S. P.; Salah, E. M.; Jackson, E. K.; Melhem, M.
Our previous studies indicate that prolonged caffeine consumption exacerbates renal failure in nephropathy associated with the metabolic syndrome. Reduced activity of the antioxidant defense system and beneficial effects of antioxidant therapy have been reported in diabetic rats and humans. The purpose of this study was to examine the early renal effects of caffeine consumption and the effects of concomitant antioxidant therapy in young obese, diabetic ZSF1 rats. Eleven-week-old male ZSF1 rats were randomized to drink tap water, caffeine (0.1%), tempol (1 mmol/L), or a solution containing caffeine and tempol for nine weeks. Caffeine significantly reduced body weight and glycosuria (weeks 2-9), improved glucose tolerance (week 9), had no effect on elevated plasma triglycerides, plasma cholesterol (week 9) and blood pressure (week 9), and significantly increased plasma cholesterol level (weeks 5 and 9). Yet, as early as after two weeks, caffeine greatly augmented proteinuria and increased renal vascular resistance (RVR) and heart rate (HR: week 9). Tempol had no effects on metabolic status and development of proteinuria, did not alter caffeine-induced metabolic changes and early proteinuria, and attenuated caffeine-induced increase in HR and RVR. Immunohistochemical analysis revealed significant glomerular and interstitial inflammation, proliferation, and fibrosis in control animals. Caffeine augmented the influx of glomerular and interstitial macrophages (ED1+ cells) influx, glomerular and tubular proliferative response, and glomerular collagen IV content. Tempol abolished the exacerbation of renal inflammation, proliferation, and fibrosis induced by caffeine. In conclusion, in nephropathy associated with the metabolic syndrome, caffeine--most likely through the interaction with adenosine receptors and interference with anti-inflammatory and/or glomerular hemodynamic effects of adenosine—augments proteinuria and stimulates some of the key proliferative mechanisms involved in glomerular remodelling and sclerosis. Tempol does not prevent early renal injury (i.e., proteinuria) induced by caffeine, yet abolishes late renal inflammatory, proliferative, and fibrotic change induced by chronic caffeine consumption in obese ZSF1 rats.
Source : Ren Fail 2007 vol.29 (7), pp 891 - 902
Maternal caffeine administration and cerebral oxygenation in near-term fetal sheep
Tomimatsu, T.; Lee, S. J.; Pena, J. P.; Ross, J. M.; Lang, J. A.; Longo, L. D.
The authors test the null hypothesis that maternal caffeine administration will not significantly alter fetal cerebral oxygenation. The authors measured fetal arterial blood gases, cortical tissue O(2) tension (tPO(2)), sagittal sinus blood gases, and laser Doppler cerebral blood flow in response to a 30-minute caffeine infusion (400 mg intravenously) into 7 near-term pregnant ewes, and they calculated fractional O(2) extraction and relative cerebral metabolic rate for O(2) (CMRO(2)). Following maternal caffeine infusion, both fetal cortical tPO(2) and sagittal sinus (HbO(2)) decreased significantly, from 10.7 +/- 0.9 to 6.8 +/- 1.1 Torr and from 46% +/- 2% to 37% +/- 6%, respectively. This was associated with significant 20% to 30% increases in fractional O(2) extraction and CMRO( 2). Fetal arterial blood gas values did not change significantly. In conclusion, maternal caffeine administration significantly decreases cerebral oxygenation without affecting systemic oxygenation in fetal sheep. The authors speculate that for a fetus that may be otherwise compromised, this increase in CMRO(2) with decreased cortical tPO(2) could present a problem.
Source : Reprod Sci 2007 vol.14 (6), pp 588 - 594
Effects of caffeine on physiological responses to exercise: boys versus men
Turley, K. R.; Desisso, T.; Gerst, J. W.
We compared the influence of caffeine on physiological responses to exercise between boys and men. Fifty-two participants (26 boys and 26 men) participated in a double blind, randomized, double crossover study. Each participant received the caffeinated (5 mg/kg) drink (CAF) and placebo (PL) twice each on 4 separate days. One hour after drink consumption preexercise heart rate (HR) and blood pressure (BP) were measured. Then while the participants rode stationary cycle ergometers at two different exercise intensities, HR, BP, and oxygen consumption (VO2) were measured. Blood pressure was not significantly affected by CAF, although on average it was always higher in boys for diastolic BP (3 mmHg) and systolic BP (3-4 mmHg) and men for diastolic BP (2-3 mmHg) and systolic BP (1-6 mmHg) both at rest and during exercise. HR was significantly (p < .05) lower at rest, 25W and 50W in CAF versus PL in boys, with no change in adults. During exercise, VO2 and respiratory exchange ratio (RER) were not different in CAF versus PL in either group. In conclusion, metabolism is not affected by a moderate caffeine dose in children or adults. The same dose has a similar effect on BP in both groups. The effect on HR was different, however, with a significant (p < .05) lowering in children in CAF versus PL, with no adult effects.
Source : Pediatr Exerc Sci 2007 vol.19 (4), pp 481 - 492
Coffee and cancer risk: an update
Vecchia, C. la; Tavani, A.
Editorial. No abstract
Source : Eur J Cancer Preven 2007 vol.16 (5), pp 385 - 389
Coffee intake and the incidence of hypertension
Voutilainen, S.; Tuomainen, T. P.; Mursu, J.; Salonen, J. T.
No abstract
Source : Am J Clin Nutr 2007 vol.86 (4), pp 1248
Immunoendocrine response to cycling following ingestion of caffeine and carbohydrate
Walker, G. J.; Finlay, O.; Griffiths, H.; Sylvester, J.; Williams, M.; Bishop, N. C.
This study investigated the effect of caffeine consumed with and without carbohydrate (CHO) on immunoendocrine responses after exercise. METHODS: On four occasions, 12 recreational male cyclists cycled for 2 h at 65% V O2max. Sixty minutes before exercise, participants ingested 6 mg.kg(-1) body mass of caffeine (CAF) or placebo (PLA), then during exercise they consumed a 6% CHO or placebo (PLA) drink, providing CAF/CHO, PLA/CHO, CAF/PLA, and PLA/PLA conditions. RESULTS: f- MLP-stimulated neutrophil oxidative burst responses were significantly higher after exercise on CAF/CHO and PLA/CHO (both P<0.05) than PLA/PLA when expressed as a percentage of baseline value. The response on CAF/PLA tended to be higher than PLA/PLA at this point (P=0.056). No significant differences between CAF/CHO, PLA/CHO, and CAF/PLA were observed after exercise; however, only PLA/CHO showed no significant postexercise decline. Coingestion of CAF/CHO significantly attenuated epinephrine (P<0.05) and IL-6 (P<0.05) responses that occurred after ingestion of CAF alone (CAF/PLA) and significantly attenuated the transient alterations in circulating leukocyte (P<0.05) and neutrophil (P<0.01) counts. Plasma cortisol concentration was significantly lower on PLA/CHO than CAF/PLA and PLA/PLA after exercise (P<0.05). Perceived exertion during exercise was significantly lower on CAF/CHO than the other three trials (P<0.05). CONCLUSION: Taken together, this suggests that coingestion of caffeine and CHO has greater influence on immunoendocrine responses than neutrophil functional responses to prolonged exercise.
Source : Med Sci Sports Exerc 2007 vol.39 (9), pp 1554 - 1560
Sex differences in mouse heart rate and body temperature and in their regulation by adenosine A1 receptors
Yang, J. N.; Tiselius, C.; Dare, E.; Johansson, B.; Valen, G.; Fredholm, B. B.
AIM: To examine cardiac function, body temperature and locomotor behaviour in the awake adenosine
A(1) receptor knock out mouse of both sexes. METHODS: Male and female A(1)R (+/+) and (-/-) mice,
instrumented with telemetric devices, were recorded during basal conditions and after drug administration.
RESULTS: Female mice had higher heart rate, body temperature and locomotion, both during daytime
and during the night. Awake A(1)R (-/-) mice had a slightly elevated heart rate, and this was more clearcut
in males. Heart rate was also higher in Langendorff-perfused denervated A(1)R (-/-) hearts. Body
temperature was higher in A(1)R (-/-) males and females; locomotor activity was higher in A(1)R (-/-)
females, but not in males. The adenosine receptor agonist R-PIA (0.2 mg kg(-1)) decreased heart rate
and body temperature, but less in A(1)R (-/-) animals than in A(1)R (+/+) mice (P < 0.001 in both
parameters). The unselective adenosine receptor antagonist caffeine had a minor stimulatory effect on
heart rate in lower doses, but depressed it at a dose of 75 mg kg(-1). Body temperature was increased
after a low dose (7.5 mg kg(-1)) of caffeine in both sexes and genotypes, and markedly reduced after a
high dose (75 mg kg(-1)) of caffeine. An intermediary dose of caffeine 30 mg kg(-1) increased or
decreased body temperature depending on genotype and sex. Locomotor responses to caffeine were
variable depending both on genotype and sex.
CONCLUSION: Thus, the adenosine A(1) receptor is involved in the regulation of heart rate, body temperature and locomotor activity, but the magnitude of the
involvement is different in males and females.
Source : Acta Physiol (Oxf) 2007 vol.190 (1), pp 63 - 75
Caffeine-activated large-conductance plasma membrane cation channels in cardiac myocytes: characteristics and significance
Zhang, Y. A.; Tuft, R. A.; Lifshitz, L. M.; Fogarty, K. E.; Singer, J. J.; Zou, H.
Caffeine-activated, large-conductance, nonselective cation channels (LCCs) have been found in the plasma membrane of isolated cardiac myocytes in several species. However, little is known about the effects of opening these channels. To examine such effects and to further understand the caffeine activation mechanism, we carried out studies using whole-cell patch-clamp techniques with freshly isolated cardiac myocytes from rats and mice. Unlike previous studies, thapsigargin was used so that both the effect of opening LCCs and the action of caffeine were independent of Ca(2+) release from intracellular stores. These Ca(2+)-permeable LCCs were found in a majority of the cells from atria and ventricles, with a conductance of approximately 370 pS in rat atria. Caffeine and all its direct metabolic products (theophylline, theobromine, and paraxanthine) activated the channel, while isocaffeine did not. Although they share some similarities with ryanodine receptors (RyRs, the openings of which give rise to Ca(2+) sparks), LCCs also showed some different characteristics. With simultaneous Ca(2+) imaging and current recording, the localized fluorescence increase due to Ca(2+) entry through a single opening of an LCC (SCCaFT) was detected. When membrane potential, instead of current, was recorded, SCCaFT-like fluorescence transients (indicating single LCC openings) were found to accompany membrane depolarizations. To our knowledge, this is the first report directly linking membrane potential changes to a single opening of an ion channel. Moreover, these events in cardiac cells suggest a possible additional mechanism by which caffeine and theophylline contribute to the generation of cardiac arrhythmias.
Source : Am J Physiol Heart Circ Physiol 2007 vol.293 (4), pp H2448 - H2461
Efficacy of dosing and re-dosing of two oral fixed combinations of indomethacin, prochlorperazine and caffeine compared with oral sumatriptan in the acute treatment of multiple migraine attacks: a doubleblind, double-dummy, randomised, parallel group, multicentre study
Sandrini, G.; Cerbo, R.; Del Bene, E.; Ferrari, A.; Genco, S.; Grazioli, I.; Martelletti, P.; Nappi, G.; Pinessi, L.; Sarchielli, P.; Tamburro, P.; Uslenghi, C.; Zanchin, G.
In this double-blind, double-dummy, randomised, parallel group, multicentre study, the efficacy of dosing and re-dosing of a fixed combination of indomethacin, prochlorperazine and caffeine (Indoprocaf) was compared with encapsulated sumatriptan in the acute treatment of two migraine attacks. Additionally, in the group taking Indoprocaf, two different oral formulations were tested: effervescent tablets and encapsulated coated tablets. RESULTS: Of 297 patients randomised (150 assigned to Indoprocaf and 147 to sumatriptan), 281 were included in the intention-to-treat efficacy analysis. The initial dosing of Indoprocaf and sumatriptan was similarly effective with pain-free rates higher than 30% (95% CI of odds-ratio: 0.57-1.28) and headache relief rates of about 60% (95% CI of odds-ratio: 0.82-1.84) with both the drugs. The efficacy of re-dosing of Indoprocaf as rescue medication was more effective than that of sumatriptan with pain-free values of 47% vs. 27% in the total attacks with a statistically significant difference in the first migraine attack in favour of Indoprocaf. The efficacy of redosing to treat a recurrence/relapse was very high without differences between the drugs (pain-free: 60% with Indoprocaf and 50% with sumatriptan in the total attacks). Indoprocaf and sumatriptan were welltolerated. CONCLUSION: The study demonstrated that the efficacy of the initial dosing of Indoprocaf was not higher than that of sumatriptan, but that the strategy to use the lowest effective dose as soon as the headache occurred, followed by a second dose if the headache has not relieved or to treat a relapse, was very effective, especially with Indoprocaf.
Source : Int J Clin Pract 2007 vol.61 (8), pp 1256 - 1269
The effects of methylmercury on motor activity are sex- and age-dependent, and modulated by genetic deletion of adenosine receptors and caffeine administration
Bjorklund, O.; Kahlstrom, J.; Salmi, P.; Ogren, S. O.; Vahter, M.; Chen, J. F.; Fredholm, B. B.; Dare, E.
Adenosine and its receptors are, as part of the brain stress response, potential targets for neuroprotective drugs. We have investigated if the adenosine receptor system affects the developmental neurotoxicity caused by the fish pollutant methylmercury (MeHg). Behavioral outcomes of low dose perinatal MeHg exposure were studied in mice where the A(1) and A(2A) adenosine receptors were either partially blocked by caffeine treatment or eliminated by genetic modification (A(1)R and A(2A)R knock-out mice). From gestational day 7 to day 7 of lactation dams were administered doses that mimic human intake via normal diet, i.e. 1microM MeHg and/or 0.3g/l caffeine in the drinking water. This exposure to MeHg resulted in a doubling of brain Hg levels in wild type females and males at postnatal day 21 (PND21). Open field analysis was performed at PND21 and 2 months of age. MeHg caused time-dependent behavioral alterations preferentially in male mice. A decreased response to amphetamine in 2-month-old males pointed to disturbances in dopaminergic functions. Maternal caffeine intake induced long-lasting changes in the offspring evidenced by an increased motor activity and a modified response to psychostimulants in adult age, irrespectively of sex. Similar alterations were observed in A(1)R knock-out mice, suggesting that adenosine A(1) receptors are involved in the alterations triggered by caffeine exposure during development. Perinatal caffeine treatment and, to some extent, genetic elimination of adenosine A(1) receptors, attenuated the behavioral consequences of MeHg in males. Importantly, also deletion of the A(2A) adenosine receptor reduced the vulnerability to MeHg, consistent with the neuroprotective effects of adenosine A(2A) receptor inactivation observed in hypoxia and Parkinson's disease. Thus, the consequences of MeHg toxicity during gestation and lactation can be reduced by adenosine A(1) and A(2A) receptor inactivation, either via their genetic deletion or by treatment with their antagonist caffeine.
Source : Toxicology 2007 vol.241 (3), pp 119 - 133
Acute effects of ingesting Java Fittrade mark energy extreme functional coffee on resting energy expenditure and hemodynamic responses in male and female coffee drinkers
Taylor, L. W.; Wilborn, C. D.; Harvey, T.; Wismann, J.; Willoughby, D. S.
The purpose of this study was to examine the effects of a functional coffee beverage containing additional caffeine, green tea extracts, niacin and garcinia cambogia to regular coffee to determine the effects on resting energy expenditure (REE) and hemodynamic variables. METHODS: Subjects included five male (26 +/- 2.1 y, 97.16 +/- 10.05 kg, 183.89 +/- 6.60 cm) and five female (28.8 +/- 5.3 y, 142.2 +/- 12.6 lbs) regular coffee drinkers. Subjects fasted for 10 hours and were assessed for 1 hour prior (PRE) and 3 hours following 1.5 cups of coffee ingestion [JavaFittrade mark Energy Extreme (JF) ~400 mg total caffeine; Folgers (F) ~200 mg total caffeine] in a double-blind, crossover design. REE, resting heart rate (RHR), and systolic (SBP) and diastolic (DBP) blood pressure was assessed at PRE and 1, 2, and 3-hours post coffee ingestion. Data were analyzed by three-factor repeated measures ANOVA (p < 0.05). RESULTS: JF trial resulted in a significant main effect for REE (p < 0.01), SBP (p < 0.01), RER (p < 0.01), and VO2 (p < 0.01) compared to F, with no difference between n trials on the RHR and DBP variables. A significant interaction for trial and time point (p < 0.05) was observed for the variable REE. The JF trial resulted in a significant overall mean increase in REE of 14.4% (males = 12.1%, females = 17.9%) over the observation period (p < 0.05), while the F trial produced an overall decrease in REE of 5.7%. SBP was significantly higher in the JF trial; however, there was no significant increase from PRE to 3-hours post. CONCLUSION: Results from this study suggest that JavaFittrade mark Energy Extreme coffee is more effective than Folgers regular caffeinated coffee at increasing REE in regular coffee drinkers for up to 3 hours following ingestion without any adverse hemodynamic effects.
Source : J Int Soc Sports Nutr 2007 vol.4 pp 10
CONSUMER SCIENCE
What adds value in specialty coffee? Managerial implications from hedonic price analysis of Central and South American e-auctions
Donnet, M. L.; Weatherspoon, D. D.; Hoehn, J. P.
The specialty coffee market has grown dramatically since the 1980s which is consistent with the trend in specialty foods. Specialty coffee E-auctions have changed the roaster's procurement information and decision making, since coffee price and quality information is fully disclosed. This study analysed this information by estimating hedonic price equations for 2 types of e-auctions: small and large vol.; the data contains 624 observations for the Cup of Excellence and 57 observations for the Q auction. By examining what makes specialty coffees different from the commodity coffees and different among themselves mainstream and specialty business models were compared and implications were drawn for supply chain managers. Results indicate that the 2 auctions trade in specialty coffees that are valued differently by their respective market segments. The value added through product differentiation is larger for the Cup of Excellence than for the Q auction. Both markets obtain price premiums over the commodity price. The Cup of Excellence e-auction reveals a significant amount of information about the values associated with coffee ratings, rankings, quantities available and country reputations. In the Q auction, information on coffee quality is more limited and tends to be remunerated to a lesser extent than in the Cup of Excellence coffees. It is concluded that in the specialty coffee model, the grower is the major player in producing the desired quality attributes. The role of coffee roaster managers is to exploit this value added through procurement strategies that preserve the origin information. On the marketing side, their role is to transmit the information to consumers to capture their effective demand for the attributes, both material and symbolic.
Source : Intern Food Agribusin Manag Rev 2007 vol.10(3)
Organic coffee packaging factors on consumer purchase intention
Lucia, S.-M. della; Rodrigues-Minim, V. P.; Osorio-Silva, C. H.; Minim, L. A.
The effect of some of the characteristics of organic coffee packaging on consumer purchase intent was studied using conjoint analysis. 4 factors, each having 2 levels, were chosen and considered, namely: price (high and low), colour of the packaging (red and green), brand name (familiar and unfamiliar), and information about organic foods (with and without the terms 'environmental-friendly product' and 'free of agrotoxic chemicals'). 16 organic coffee bags were created following a complete factorial design, which were then evaluated by 144 consumers based on their intention to purchase. Data were analysed using the clustering segmentation model. The familiar brand name positively affected the intention to purchase of 93% of the consumers. High-priced organic coffee packaging had a negative impact on all the participants' intention to purchase. The colour of the packaging had little impact on the consumers' evaluation. Printed information about organic foods positively affected the intention to purchase of 79% of the participants, demonstrating that consumers want to find information about the product printed on its packaging.
Source : Ciencia e Tecnologia de Alimentos 2007 vol.27 (3), pp 485 - 491
Service quality and training: a pilot study
Monk, D.; Ryding, D.
An initial investigation was conducted into the strategic implications of providing training to all employees of coffee shops in the UK, including baristas (coffee makers) on temporary or part-time job contracts. In particular, the study sought to investigate whether service quality could be significantly improved by devoting substantial resources to staff training. 2 focus groups were conducted to obtain a demand side picture of this market. One of these groups comprised customers under the age of 30 yrs and the other was made up of customers between 30 and 50 yrs of age. Managers of 2 coffee shops were interviewed to get a supply side view. The attitudes of the 2 focus groups were surprisingly similar. Generally, customers did not expect more than basic product knowledge from their baristas. On the supply side, it emerged that the coffee chains provided basic training to all of their employees. This training was firm specific and revolved around a workbook that employees completed in a matter of wks. Current spending by firms on front line staff typically amounts to approx. GBP 200/person per yr. Results suggest that coffee shops are behaving rationally in providing limited training to their staff. There is no evidence, on the demand side, that perceptions of service quality would be enhanced by spending significantly more on training baristas. However, this market is a highly volatile one and customer expectations may well change in the near future.
Source : Brit Food J 2007 vol.109 (8), pp 627-636
Certified coffee: does the premium pay off?
Taylor, D. A.
No abstract. For full text, source link.
Source : Environ Health Perspect 2007 vol.115 (9), pp A456 - A459